ID: 1122554671

View in Genome Browser
Species Human (GRCh38)
Location 14:102571308-102571330
Sequence CCTGCTTTGCAGGCTGGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122554663_1122554671 -1 Left 1122554663 14:102571286-102571308 CCAGGACCACCTGCATCTACTGC No data
Right 1122554671 14:102571308-102571330 CCTGCTTTGCAGGCTGGGCTGGG No data
1122554665_1122554671 -10 Left 1122554665 14:102571295-102571317 CCTGCATCTACTGCCTGCTTTGC No data
Right 1122554671 14:102571308-102571330 CCTGCTTTGCAGGCTGGGCTGGG No data
1122554659_1122554671 23 Left 1122554659 14:102571262-102571284 CCTGCAAGCTGTGTGCAAGCCGG No data
Right 1122554671 14:102571308-102571330 CCTGCTTTGCAGGCTGGGCTGGG No data
1122554664_1122554671 -7 Left 1122554664 14:102571292-102571314 CCACCTGCATCTACTGCCTGCTT No data
Right 1122554671 14:102571308-102571330 CCTGCTTTGCAGGCTGGGCTGGG No data
1122554662_1122554671 4 Left 1122554662 14:102571281-102571303 CCGGTCCAGGACCACCTGCATCT No data
Right 1122554671 14:102571308-102571330 CCTGCTTTGCAGGCTGGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122554671 Original CRISPR CCTGCTTTGCAGGCTGGGCT GGG Intergenic
No off target data available for this crispr