ID: 1122558103

View in Genome Browser
Species Human (GRCh38)
Location 14:102592327-102592349
Sequence CTGCCTGGAGAGATGGATCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122558091_1122558103 23 Left 1122558091 14:102592281-102592303 CCGCGGCCAAGGGTAGGGGGCGG No data
Right 1122558103 14:102592327-102592349 CTGCCTGGAGAGATGGATCATGG No data
1122558096_1122558103 17 Left 1122558096 14:102592287-102592309 CCAAGGGTAGGGGGCGGGGAGGG No data
Right 1122558103 14:102592327-102592349 CTGCCTGGAGAGATGGATCATGG No data
1122558098_1122558103 -6 Left 1122558098 14:102592310-102592332 CCGCGAACTCCTCGCCGCTGCCT No data
Right 1122558103 14:102592327-102592349 CTGCCTGGAGAGATGGATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122558103 Original CRISPR CTGCCTGGAGAGATGGATCA TGG Intergenic
No off target data available for this crispr