ID: 1122563769

View in Genome Browser
Species Human (GRCh38)
Location 14:102636450-102636472
Sequence TGTATTTGTTTACTAGAGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 20414
Summary {0: 1, 1: 12, 2: 1016, 3: 4036, 4: 15349}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122563759_1122563769 30 Left 1122563759 14:102636397-102636419 CCTCCCAAGTAGCTGGGATTACA 0: 48952
1: 142577
2: 242332
3: 522592
4: 386712
Right 1122563769 14:102636450-102636472 TGTATTTGTTTACTAGAGATAGG 0: 1
1: 12
2: 1016
3: 4036
4: 15349
1122563766_1122563769 -9 Left 1122563766 14:102636436-102636458 CCCCGCTAACTTTTTGTATTTGT 0: 1
1: 19
2: 2725
3: 77698
4: 48792
Right 1122563769 14:102636450-102636472 TGTATTTGTTTACTAGAGATAGG 0: 1
1: 12
2: 1016
3: 4036
4: 15349
1122563765_1122563769 -4 Left 1122563765 14:102636431-102636453 CCACACCCCGCTAACTTTTTGTA 0: 4
1: 350
2: 10411
3: 40016
4: 53291
Right 1122563769 14:102636450-102636472 TGTATTTGTTTACTAGAGATAGG 0: 1
1: 12
2: 1016
3: 4036
4: 15349
1122563761_1122563769 27 Left 1122563761 14:102636400-102636422 CCCAAGTAGCTGGGATTACAGGT 0: 15366
1: 98640
2: 233329
3: 337639
4: 469862
Right 1122563769 14:102636450-102636472 TGTATTTGTTTACTAGAGATAGG 0: 1
1: 12
2: 1016
3: 4036
4: 15349
1122563763_1122563769 3 Left 1122563763 14:102636424-102636446 CCTGCCACCACACCCCGCTAACT 0: 2
1: 332
2: 12946
3: 50978
4: 85758
Right 1122563769 14:102636450-102636472 TGTATTTGTTTACTAGAGATAGG 0: 1
1: 12
2: 1016
3: 4036
4: 15349
1122563762_1122563769 26 Left 1122563762 14:102636401-102636423 CCAAGTAGCTGGGATTACAGGTG 0: 27298
1: 77225
2: 165100
3: 221696
4: 302720
Right 1122563769 14:102636450-102636472 TGTATTTGTTTACTAGAGATAGG 0: 1
1: 12
2: 1016
3: 4036
4: 15349
1122563767_1122563769 -10 Left 1122563767 14:102636437-102636459 CCCGCTAACTTTTTGTATTTGTT 0: 1
1: 194
2: 7166
3: 55734
4: 43740
Right 1122563769 14:102636450-102636472 TGTATTTGTTTACTAGAGATAGG 0: 1
1: 12
2: 1016
3: 4036
4: 15349
1122563764_1122563769 -1 Left 1122563764 14:102636428-102636450 CCACCACACCCCGCTAACTTTTT 0: 7
1: 684
2: 20270
3: 101571
4: 192631
Right 1122563769 14:102636450-102636472 TGTATTTGTTTACTAGAGATAGG 0: 1
1: 12
2: 1016
3: 4036
4: 15349

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122563769 Original CRISPR TGTATTTGTTTACTAGAGAT AGG Intronic
Too many off-targets to display for this crispr