ID: 1122574987

View in Genome Browser
Species Human (GRCh38)
Location 14:102736352-102736374
Sequence AGGTGCTTCTGGCCCAGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122574987_1122574994 17 Left 1122574987 14:102736352-102736374 CCAGAGCTGGGCCAGAAGCACCT No data
Right 1122574994 14:102736392-102736414 TACAGCCTCTGTCACTCTCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122574987 Original CRISPR AGGTGCTTCTGGCCCAGCTC TGG (reversed) Intergenic
No off target data available for this crispr