ID: 1122574988

View in Genome Browser
Species Human (GRCh38)
Location 14:102736363-102736385
Sequence GCTACGGTTTTAGGTGCTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122574988_1122574994 6 Left 1122574988 14:102736363-102736385 CCAGAAGCACCTAAAACCGTAGC No data
Right 1122574994 14:102736392-102736414 TACAGCCTCTGTCACTCTCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122574988 Original CRISPR GCTACGGTTTTAGGTGCTTC TGG (reversed) Intergenic
No off target data available for this crispr