ID: 1122574990

View in Genome Browser
Species Human (GRCh38)
Location 14:102736379-102736401
Sequence AGAGGCTGTAAGGTGGGCTA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122574990_1122574994 -10 Left 1122574990 14:102736379-102736401 CCGTAGCCCACCTTACAGCCTCT No data
Right 1122574994 14:102736392-102736414 TACAGCCTCTGTCACTCTCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122574990 Original CRISPR AGAGGCTGTAAGGTGGGCTA CGG (reversed) Intergenic
No off target data available for this crispr