ID: 1122574994

View in Genome Browser
Species Human (GRCh38)
Location 14:102736392-102736414
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122574990_1122574994 -10 Left 1122574990 14:102736379-102736401 CCGTAGCCCACCTTACAGCCTCT No data
Right 1122574994 14:102736392-102736414 TACAGCCTCTGTCACTCTCTCGG No data
1122574987_1122574994 17 Left 1122574987 14:102736352-102736374 CCAGAGCTGGGCCAGAAGCACCT No data
Right 1122574994 14:102736392-102736414 TACAGCCTCTGTCACTCTCTCGG No data
1122574989_1122574994 -3 Left 1122574989 14:102736372-102736394 CCTAAAACCGTAGCCCACCTTAC No data
Right 1122574994 14:102736392-102736414 TACAGCCTCTGTCACTCTCTCGG No data
1122574988_1122574994 6 Left 1122574988 14:102736363-102736385 CCAGAAGCACCTAAAACCGTAGC No data
Right 1122574994 14:102736392-102736414 TACAGCCTCTGTCACTCTCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122574994 Original CRISPR TACAGCCTCTGTCACTCTCT CGG Intergenic