ID: 1122582315

View in Genome Browser
Species Human (GRCh38)
Location 14:102778098-102778120
Sequence CCGGGCCCCCCCGGCCGGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 690
Summary {0: 1, 1: 0, 2: 6, 3: 64, 4: 619}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122582315_1122582325 19 Left 1122582315 14:102778098-102778120 CCGGGCCGGCCGGGGGGGCCCGG 0: 1
1: 0
2: 6
3: 64
4: 619
Right 1122582325 14:102778140-102778162 CCTGAGTCATTCCGCCTCAGAGG 0: 1
1: 0
2: 0
3: 8
4: 118
1122582315_1122582322 -5 Left 1122582315 14:102778098-102778120 CCGGGCCGGCCGGGGGGGCCCGG 0: 1
1: 0
2: 6
3: 64
4: 619
Right 1122582322 14:102778116-102778138 CCCGGGCGTTATTGGAAAGTTGG 0: 1
1: 0
2: 0
3: 2
4: 27

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122582315 Original CRISPR CCGGGCCCCCCCGGCCGGCC CGG (reversed) Intronic
900252105 1:1676287-1676309 CTGGGCTCCCCCGGCCCTCCCGG + Intronic
900262515 1:1739145-1739167 CTGGGCTCCCCCGGCCCTCCCGG + Intronic
900482258 1:2905018-2905040 CCTGCCCTGCCCGGCCGGCCAGG + Intergenic
901005586 1:6170286-6170308 CAGGCCCCCACCGCCCGGCCTGG + Intronic
901068853 1:6507486-6507508 CTGTGCCCCCCCAGCCTGCCAGG + Intronic
901373264 1:8818049-8818071 CCGCGCCCCCCGGGCTGGGCCGG + Intergenic
901489380 1:9588957-9588979 CCGCTGCCCCACGGCCGGCCTGG + Exonic
901676574 1:10889014-10889036 CCCGCCCGCCCCGGCCGCCCAGG - Intergenic
901882434 1:12202130-12202152 CCGGGCCTCCCCGGCCCCACTGG - Exonic
902314094 1:15604620-15604642 CATGGCCCCTCCGGCCAGCCGGG + Intergenic
902769599 1:18637875-18637897 CCGTGGCCCCTCGGCAGGCCGGG - Intronic
903034738 1:20486317-20486339 CGGGGCCGCGCCGGCCGGCCCGG + Intergenic
903628228 1:24745980-24746002 CCGGGCCCCGGCGCCCGGGCGGG - Intronic
903925173 1:26826759-26826781 CCGCGCCCCGCGGGCCGGCCGGG - Exonic
904253062 1:29238040-29238062 CCTGGCGGTCCCGGCCGGCCGGG - Intronic
904603168 1:31684575-31684597 CCGGGCACCACAGGGCGGCCAGG - Exonic
904604523 1:31691448-31691470 CCTGGGCCCCCCGGCCTCCCTGG - Exonic
905028378 1:34866055-34866077 CCGGCCCGCCCAGCCCGGCCCGG - Exonic
905169021 1:36098986-36099008 CCCGGCCCCCCCGGCCTCCCTGG - Exonic
905734345 1:40315615-40315637 CCGGGTCCCCCGGGACCGCCGGG - Exonic
905846958 1:41241761-41241783 CCGGGGCCCCCGGGCAGTCCTGG + Intronic
905912175 1:41662479-41662501 CGGGGACCCCGCCGCCGGCCCGG + Intronic
906214333 1:44030383-44030405 CCGGCCCCTCCCGGCCCTCCGGG + Intronic
906225606 1:44119007-44119029 CTGGGCCCGCCCGGCCTGCCAGG - Intronic
906535781 1:46550328-46550350 CAGGGCCCCCAGGGCCGGACTGG + Intronic
907364371 1:53946568-53946590 CCGGGGCCCCGCGAGCGGCCCGG - Intronic
907766936 1:57422312-57422334 CCGGTCCCCGCCGGCTGGCTAGG + Intronic
907920120 1:58904030-58904052 CCGCGGCCTCCCGGCCCGCCAGG + Intergenic
908401325 1:63774701-63774723 CCGGAGCCCCGCGGCGGGCCGGG + Intronic
909001412 1:70221673-70221695 CCGGGCCCCAGCGGCGGGCCCGG + Exonic
912670523 1:111620089-111620111 TCCGGCCCCTCCCGCCGGCCAGG - Intronic
914066852 1:144250430-144250452 CCCGGTGCCCCCGGCCCGCCCGG - Intergenic
914112301 1:144715924-144715946 CCCGGTGCCCCCGGCCCGCCCGG + Intergenic
915458091 1:156053751-156053773 CCCCGCCCGCCCGGCCGGCCCGG + Exonic
915565712 1:156711488-156711510 CCAGGGCCCCCCAGCCTGCCCGG + Intergenic
918040945 1:180913315-180913337 CCACCCCCGCCCGGCCGGCCCGG - Intronic
918041527 1:180916755-180916777 CCAGGACCCCCAGGCCGTCCGGG - Exonic
919926415 1:202194058-202194080 CGGCGCCCCCCAGCCCGGCCCGG + Exonic
920071545 1:203306112-203306134 TCGGGACCCCTCGGCCGACCGGG - Intronic
921376847 1:214483395-214483417 CAGTGCCCACCCGGTCGGCCTGG - Intronic
922116473 1:222618361-222618383 CTGCGACCCCCGGGCCGGCCAGG - Intronic
922250593 1:223845857-223845879 CCGGGCTCCCCCGCCCCGGCCGG + Exonic
922518200 1:226223741-226223763 CCGGGCCCCCCACGCCGGCGGGG + Exonic
922539492 1:226408151-226408173 GCGCGCGCCCCCTGCCGGCCGGG + Intergenic
923506437 1:234609737-234609759 GCAGTTCCCCCCGGCCGGCCCGG + Intergenic
923678627 1:236101181-236101203 CCGGGCCCCTGAGGCCGCCCTGG + Intergenic
923783139 1:237042920-237042942 CTGGGACCTCCCGGGCGGCCGGG + Intronic
924172604 1:241357321-241357343 CCGGGCCTCCCGGGCCTCCCCGG + Intergenic
924436581 1:244048641-244048663 CCCCGCCCCCCCACCCGGCCCGG + Intergenic
924560548 1:245154350-245154372 GGGTGGCCCCCCGGCCGGCCCGG + Intergenic
924763141 1:247007710-247007732 CCGGGATCCCGCTGCCGGCCCGG + Intronic
924823662 1:247518336-247518358 CCCGGCCACCCCAGCCGCCCTGG + Intronic
1062843720 10:689467-689489 CCGGGCCCCCGCCCCGGGCCGGG - Intronic
1064209005 10:13347888-13347910 CCGGGCCGCCCGGGACCGCCGGG - Intronic
1064552848 10:16520740-16520762 CCGGGCGCCCCGGGCGGGCCCGG + Exonic
1064552847 10:16520740-16520762 CCGGGCCCGCCCGGGGCGCCCGG - Exonic
1064552855 10:16520758-16520780 CCGGGCCGCCAAGGCCTGCCGGG - Exonic
1065021991 10:21508959-21508981 CGGGGTCCCCCAGGCCCGCCCGG + Intergenic
1065025230 10:21534540-21534562 CCGGCGCCCCCCGCCCGGCCCGG - Intronic
1065533641 10:26697778-26697800 CCCGGCTCCCCCGGCCGTGCGGG + Exonic
1067091173 10:43266550-43266572 CCGGCCCGGCCCGGCCCGCCAGG + Intronic
1067142347 10:43667980-43668002 CGGGGCCCCTCCGGCCGCCCCGG - Intergenic
1069024041 10:63521329-63521351 CCCGCCCCCGCCCGCCGGCCCGG - Intergenic
1069662477 10:70132677-70132699 CCGGGCGCCCCGGGCGGGACCGG - Intronic
1070877289 10:79826082-79826104 CCCGGCCCCGCCGCCCGCCCCGG + Intergenic
1071643786 10:87342126-87342148 CCCGGCCCCGCCGCCCGCCCCGG + Intergenic
1073122541 10:101131513-101131535 CCGGGCCCCCCGGTGGGGCCAGG + Exonic
1073122540 10:101131513-101131535 CCTGGCCCCACCGGGGGGCCCGG - Exonic
1073509280 10:104033318-104033340 CAGGGCCCACCAGGCCAGCCTGG - Exonic
1073509764 10:104035509-104035531 CCGGGGCCCCCTGGCTTGCCGGG - Exonic
1075874093 10:125792338-125792360 CTGGGCCCCCTCGCCTGGCCTGG - Intronic
1076948186 10:133665619-133665641 CCGGGCCCCTGCAGCCGCCCAGG + Intergenic
1076949175 10:133668929-133668951 CCGGGCCCCTGCAGCCGCCCAGG + Intronic
1076950159 10:133672228-133672250 CCGGGCCCCTGCAGCCGCCCAGG + Intergenic
1076951144 10:133675527-133675549 CCGGGCCCCTGCAGCCGCCCAGG + Intergenic
1076952134 10:133678837-133678859 CCGGGCCCCTGCAGCCGCCCAGG + Intergenic
1076953122 10:133682147-133682169 CCGGGCCCCTGCAGCCGCCCAGG + Intergenic
1076954106 10:133685446-133685468 CCGGGCCCCTGCAGCCGCCCAGG + Intergenic
1076955090 10:133741798-133741820 CCGGGCCCCTGCAGCCGCCCAGG + Intergenic
1076956080 10:133745108-133745130 CCGGGCCCCTGCAGCCGCCCAGG + Intergenic
1076958057 10:133751727-133751749 CCGGGCCCCTGCAGCCGCCCAGG + Intergenic
1076959041 10:133755026-133755048 CCGGGCCCCTGCAGCCGCCCAGG + Intergenic
1076960030 10:133758336-133758358 CCGGGCCCCTGCAGCCGCCCAGG + Intergenic
1076961014 10:133761635-133761657 CCGGGCCCCTGCAGCCGCCCAGG + Intergenic
1076996423 11:299439-299461 CCGGGCCCCCACGCCCAGCAAGG - Exonic
1077053122 11:576606-576628 CAGGGCCCCCAGGGCCGGCGCGG - Intronic
1077201401 11:1309315-1309337 CCGCTCCCCTCCGGCCGGCCAGG + Intronic
1077240895 11:1510037-1510059 CCGGGTCCCCCCCGCAGCCCTGG - Intergenic
1077240921 11:1510103-1510125 CCGGGTCCCCCCCGCAGCCCTGG - Intergenic
1077240935 11:1510136-1510158 CCGGGTCCCCCCCGCAGCCCTGG - Intergenic
1077240949 11:1510169-1510191 CCGGGTCCCCCCCGCAGCCCTGG - Intergenic
1077240987 11:1510265-1510287 CCGGGTCCCCCCCGCAGCCCTGG - Intergenic
1077241001 11:1510298-1510320 CCGGGTCCCCCCCGCAGCCCTGG - Intergenic
1077250018 11:1556879-1556901 CCGGGGCCGGCCGGCTGGCCAGG + Exonic
1077491520 11:2862969-2862991 CCGGGACCCCCTGCCCGGCCCGG + Intergenic
1077544971 11:3165243-3165265 CCCCGCGCGCCCGGCCGGCCCGG - Exonic
1077922996 11:6655532-6655554 CCGCGCCCGCCCGGCCCGTCTGG - Intronic
1078631794 11:13010037-13010059 CGGGGCCCCGCGGGCCGGACAGG - Intergenic
1078660053 11:13278582-13278604 CCGGGAATCCCCGGCCGGCACGG + Intronic
1080677119 11:34438685-34438707 CCGGGCACCCCGGGCCGGCGGGG + Intergenic
1081573842 11:44307402-44307424 CTGGGCCCCCACAGCCAGCCTGG - Intronic
1081807154 11:45896850-45896872 CCGCAGCCCCCCGGCCGGGCAGG + Intronic
1081967028 11:47176462-47176484 CCAGACACCCCTGGCCGGCCGGG + Intronic
1083437068 11:62649803-62649825 CCGGGCCCACCTGGCTGCCCTGG - Exonic
1083811658 11:65109931-65109953 CAGGGCTACCCCGGCCAGCCTGG - Intronic
1083928376 11:65823426-65823448 CCAGGCCCCACTGGCCTGCCTGG - Intronic
1084010923 11:66347814-66347836 CCGGGCCCCGCCGGCTTCCCGGG + Intergenic
1085011057 11:73142103-73142125 CCGGGCCGCCCGGGCCGCCCGGG - Exonic
1087014502 11:93542873-93542895 CGGGGCCCTCCCGGCCGCCCCGG + Intronic
1089560152 11:119339775-119339797 CGGGGCCCACCGGGCCTGCCGGG - Exonic
1089560322 11:119340291-119340313 CCGGGGCACCCCGGCCTTCCAGG - Exonic
1091434320 12:460864-460886 CCGGGCCCCTCCAGCCGCTCCGG + Intronic
1091823081 12:3490989-3491011 CTGGGCCCCCCGCGCGGGCCTGG + Intronic
1092492388 12:8957040-8957062 CAGGGCCCCCCCGGCCGTGGAGG + Intronic
1092906050 12:13101407-13101429 CCGGGTACCCCCGCCCGACCCGG - Intronic
1093958851 12:25251115-25251137 CCGCTCCTCCCCCGCCGGCCCGG - Intergenic
1094025733 12:25958627-25958649 CCTGGCCGCCCGGCCCGGCCCGG + Intergenic
1094025732 12:25958627-25958649 CCGGGCCGGGCCGGGCGGCCAGG - Intergenic
1094041521 12:26125136-26125158 CCCGACGCCCCCGCCCGGCCCGG - Intronic
1095261791 12:40106112-40106134 CGGGCCCCGCCCCGCCGGCCCGG - Intergenic
1095752887 12:45729989-45730011 CCGGGACCCCGTGCCCGGCCCGG - Intronic
1096154828 12:49336197-49336219 CCAGGCCCCCCGGGCCCTCCCGG - Exonic
1096156764 12:49345477-49345499 CCGCCCCTTCCCGGCCGGCCCGG - Intergenic
1096215016 12:49793782-49793804 CCGGGGCCCACAGGCTGGCCAGG + Exonic
1096389287 12:51217108-51217130 CCGGGTCCCACCGGTCGTCCCGG + Intronic
1096389631 12:51218194-51218216 CCGGGACCTCCCGCTCGGCCAGG - Intergenic
1097274530 12:57803475-57803497 CTGGGCTCCCCCTGCCTGCCAGG - Intronic
1097288724 12:57896698-57896720 CCGGGCCCAGCCCGCCGCCCGGG + Intergenic
1100611400 12:96194356-96194378 CCGCGCCTCCCCCGCCGCCCCGG - Intergenic
1101365246 12:104064612-104064634 CCGGTCCCCCGCGCCCGGCACGG + Exonic
1102853904 12:116277322-116277344 GCGCGCCCCCCCCGCCAGCCCGG - Exonic
1102854149 12:116278089-116278111 CCGCGCCACGCCAGCCGGCCTGG - Intergenic
1103410928 12:120710815-120710837 CCAGACCCCCTCGGCCGGCCGGG + Intronic
1103649659 12:122422712-122422734 CCGCGCCCGCCCGGCCGGCCCGG + Intergenic
1103649663 12:122422721-122422743 CCGGGCCGGCCGGGCCGGCCGGG - Intergenic
1103649664 12:122422721-122422743 CCCGGCCGGCCCGGCCGGCCCGG + Intergenic
1103775674 12:123364850-123364872 CCCAGCCCCCCCGCCCCGCCGGG + Intergenic
1103948406 12:124539471-124539493 CCGGGTTCCCCCAGCCTGCCTGG - Intronic
1104983405 12:132583657-132583679 CCGGGCCCCCCACGCCCCCCGGG + Exonic
1107133588 13:36920552-36920574 CCGGGCCACCCCGGCAGGCCGGG - Intronic
1107150467 13:37105319-37105341 CCGGGGCCCACCGGCCCGCAAGG + Exonic
1107561178 13:41558921-41558943 CCGGGCAGCCCAGGCCTGCCTGG - Intergenic
1110219513 13:73058898-73058920 CCGAGGCCCCGAGGCCGGCCAGG - Exonic
1110705950 13:78602197-78602219 CCGGGCCGCCGCCGCCGCCCGGG + Exonic
1110706839 13:78607389-78607411 CCGGGCCCCACTTGCAGGCCCGG + Intergenic
1111951832 13:94713713-94713735 CCCGGCTACCCAGGCCGGCCTGG + Intergenic
1112402218 13:99086765-99086787 CCGGGCCGCGCCGACCTGCCTGG - Intergenic
1112505166 13:99970904-99970926 CCGGGCCGCCGCTGCCGTCCGGG + Exonic
1112507716 13:99985170-99985192 CCGGACCACCTCAGCCGGCCTGG + Intronic
1112613083 13:100975793-100975815 GCGGGCCGGCCCTGCCGGCCCGG + Intergenic
1113379152 13:109786828-109786850 CCGCCCCACCCCGCCCGGCCGGG - Intergenic
1113426029 13:110209399-110209421 CCAGGCCCTCCCGGCCCTCCAGG - Exonic
1113461559 13:110485696-110485718 CCGGGCCTCCCAGGCAGCCCAGG - Exonic
1113517378 13:110914347-110914369 CGGGGCCCTCCAGGCCGGGCCGG - Intronic
1113643594 13:111976245-111976267 CGGGGCCGGCCCGGCCAGCCAGG - Intergenic
1113861915 13:113491703-113491725 CCGAGTCCACCCGGGCGGCCAGG - Intronic
1114194953 14:20469215-20469237 CCGGCTCCCCCCGCCCGCCCCGG + Intronic
1114485153 14:23057632-23057654 CCGACCCTCCCCGGCCAGCCGGG + Intergenic
1114491666 14:23106200-23106222 CCGGCCTCCCCCGGCCTGCCTGG + Intergenic
1114635373 14:24184156-24184178 CCGGGCTCCCCCATCCTGCCTGG - Intronic
1114653215 14:24299796-24299818 CCGCGCCGCCCCAGCCGGGCGGG - Exonic
1115545608 14:34462519-34462541 CCGCCCACCACCGGCCGGCCCGG - Intronic
1117302230 14:54441154-54441176 CCGGGCCGCCACGGCCGCCGGGG - Intronic
1117424492 14:55580450-55580472 CCGCGCCCCCCCGCCCGGCGCGG - Intronic
1117978539 14:61321165-61321187 CCGTGCCCCCGCCTCCGGCCAGG + Intronic
1118019542 14:61696098-61696120 CGAGGCCCCCACGGCCGGCGGGG - Intronic
1118024076 14:61751198-61751220 CCGGGCCCCGCCCGCGGCCCCGG + Intergenic
1118627808 14:67674874-67674896 CCGGGCCCCGCCGGCCGGCGAGG + Intronic
1118752345 14:68816419-68816441 CCCGGGCCCCGCGCCCGGCCCGG - Intergenic
1121667871 14:95686349-95686371 CCCCGCCCCCACTGCCGGCCCGG + Intergenic
1122130875 14:99604106-99604128 CCGGGCGGCCCCGGCGGGCGCGG - Intergenic
1122153605 14:99737698-99737720 GCGTCCCGCCCCGGCCGGCCTGG - Intronic
1122325860 14:100880316-100880338 ACGGGGCCCCCCACCCGGCCTGG - Intergenic
1122417255 14:101556352-101556374 CAGGGCCCTCCAGCCCGGCCTGG - Intergenic
1122582315 14:102778098-102778120 CCGGGCCCCCCCGGCCGGCCCGG - Intronic
1122688964 14:103522660-103522682 CCGGGGACCCCCGGCCGGTCCGG + Intronic
1122848457 14:104513562-104513584 CCGGGCCCAGCCACCCGGCCTGG - Intronic
1122978557 14:105181083-105181105 CCGCGCCCCCGCCGGCGGCCCGG - Intronic
1123439933 15:20282833-20282855 CCCGGCCCACCCGTCCGCCCGGG - Intergenic
1123474784 15:20582022-20582044 CCGGACTCCCTCGGACGGCCTGG - Intergenic
1123474914 15:20582558-20582580 CCAGGCCCCTCCAGCCCGCCTGG - Intergenic
1123630558 15:22257611-22257633 CCGGGCAGCCCGGGCCGGCCGGG - Intergenic
1123643097 15:22417799-22417821 CCAGGCCCCTCCAGCCCGCCTGG + Intergenic
1123643227 15:22418335-22418357 CCGGACTCCCTCGGACGGCCTGG + Intergenic
1124377853 15:29140004-29140026 CCTCGCCCCGCAGGCCGGCCAGG - Intronic
1124500858 15:30225456-30225478 CCGGGCCGCCGCGCCCAGCCCGG + Intergenic
1124629242 15:31327556-31327578 CCGCGCCCCCCAGCCCGGCGTGG + Exonic
1124742712 15:32313211-32313233 CCGGGCCGCCGCGCCCAGCCCGG - Intergenic
1125594043 15:40873273-40873295 CGGGGCCCTCCCGGCCCCCCTGG + Exonic
1126649734 15:50908697-50908719 CCCGGCCGCCGCTGCCGGCCCGG - Exonic
1128109619 15:65068133-65068155 CCGCGCCCCCACCGCCGGGCTGG + Intronic
1128391859 15:67187651-67187673 CCCGGCCCCTCCTGCCTGCCAGG - Intronic
1129351202 15:74956842-74956864 CCGGGCGGGCCCGGCCGGGCCGG - Exonic
1129853906 15:78811090-78811112 CCGCCCCTCCCCGGCCAGCCGGG - Intronic
1130276113 15:82477148-82477170 CTGGGGCCCCTCGGACGGCCTGG + Intergenic
1130520565 15:84658126-84658148 CCGAGCGCCCCCCGCCCGCCGGG + Exonic
1131827452 15:96332282-96332304 CCGGGCCGCCAGGGCCGCCCTGG - Exonic
1131827978 15:96334918-96334940 CCAGGCCCCCCGGGCCTGCTGGG + Intronic
1132398260 15:101489623-101489645 CCGGGCCCCGGCCGCCGCCCCGG - Exonic
1132522221 16:397120-397142 CCGGGAGCCCCCCGCCGCCCCGG - Intronic
1132527780 16:426067-426089 CCCGGCCCGTCCGGCCCGCCCGG - Exonic
1132548459 16:544310-544332 CGGGGCTGCCCCGGCCGGACGGG + Intronic
1132551677 16:556296-556318 CCGCTCCCCACTGGCCGGCCAGG + Intergenic
1132589744 16:721450-721472 CCGAGCTCCCCTGCCCGGCCTGG - Intronic
1132623644 16:879843-879865 CAGGATCCCCCCGGCCCGCCTGG + Intronic
1132674024 16:1114275-1114297 CAGGGCTCCCCTTGCCGGCCAGG - Intergenic
1132756537 16:1488008-1488030 CCCGTCCCGCCCAGCCGGCCCGG - Intronic
1132779293 16:1614160-1614182 CTGCGCCGCCTCGGCCGGCCGGG - Intronic
1132884956 16:2178516-2178538 CCGGGCCCTCCCGCGCCGCCCGG - Exonic
1132938761 16:2496546-2496568 CAGGGCCACCACGGCCGGCAGGG - Exonic
1132968608 16:2673598-2673620 CCGGGCCTCTCCCGCCCGCCAGG - Intergenic
1133156765 16:3881090-3881112 CCGGGCCCGCCCGTCCCGCTGGG + Intergenic
1133198040 16:4184518-4184540 GCGGGGTCCCCCGGGCGGCCAGG + Intergenic
1133286747 16:4694252-4694274 CCGGGCCCCGCCCCCCGCCCCGG + Intronic
1133298471 16:4767154-4767176 GCGGGCCCACCCGCACGGCCTGG - Exonic
1133784481 16:8963715-8963737 CAGGCCCGCCGCGGCCGGCCAGG - Intronic
1135691292 16:24539837-24539859 CCGGGCCCCAGCCGGCGGCCGGG - Intronic
1136344446 16:29665774-29665796 CTGGGCCCCCCAGGCCAGCCTGG + Exonic
1136365256 16:29806597-29806619 GCGGCCCAGCCCGGCCGGCCGGG + Exonic
1136402278 16:30025194-30025216 CCGGCCGCCCCCGGCCTGCCAGG - Exonic
1136497420 16:30652803-30652825 CCTCGCCACCCCGGCAGGCCGGG + Exonic
1136497481 16:30653037-30653059 CCGGGCCCCCCAGCCCACCCTGG + Exonic
1136707776 16:32202916-32202938 CGGGGTCCCCCGGGCCGCCCGGG - Intergenic
1136760133 16:32726495-32726517 CGGGGTCCCCCGGGCCGCCCGGG + Intergenic
1136807971 16:33143891-33143913 CGGGGTCCCCCGGGCCGCCCGGG - Intergenic
1137614565 16:49838915-49838937 CGGGGCCGCCCCCGCGGGCCGGG + Intronic
1137668663 16:50266646-50266668 CCCGGCCCCAGCAGCCGGCCAGG - Intronic
1138180968 16:54939797-54939819 CCGGGACGCCCTGCCCGGCCTGG - Intergenic
1138516077 16:57536207-57536229 CCGCCCCCTCCCGTCCGGCCCGG + Intronic
1138558940 16:57788609-57788631 CCGGGCCTCCCGGGCCCGCCTGG + Intronic
1138595301 16:58026363-58026385 CCGAGCGCGCCCGGACGGCCGGG + Exonic
1139544817 16:67645221-67645243 TTGGGCCTCCCCGGCCCGCCCGG + Exonic
1139637088 16:68264400-68264422 CCGGGCCCCCGTGGCCGCCACGG - Intergenic
1139750553 16:69106789-69106811 CGGGCCCCTCCAGGCCGGCCAGG - Intronic
1139761360 16:69187113-69187135 CCGGGCCCGCCCCTCCGGGCGGG + Exonic
1140068089 16:71626746-71626768 CAGGGCCTCGCGGGCCGGCCTGG - Intronic
1140221480 16:73047712-73047734 CCGGGTCCGCGCAGCCGGCCTGG - Intronic
1141054752 16:80804562-80804584 CCCGGCGCCCGCCGCCGGCCCGG + Intergenic
1141694434 16:85613029-85613051 CCCGGCTCACCTGGCCGGCCGGG + Intronic
1141712869 16:85710115-85710137 CCGGGCCCCCACAGCCGACCCGG + Intronic
1141727571 16:85799788-85799810 CCCGGCCCCCCGACCCGGCCCGG - Exonic
1141730220 16:85817370-85817392 CCTGGCCCCCCTGGCTGGGCTGG + Intergenic
1141830140 16:86505792-86505814 CCCCGCCCGCGCGGCCGGCCTGG + Intergenic
1141972357 16:87492478-87492500 CCCGGCCGCCCCGGCCGCCCCGG - Intergenic
1142156415 16:88534601-88534623 CGGCGCGCCCCTGGCCGGCCCGG + Exonic
1142156421 16:88534610-88534632 CCTCGACCCCCGGGCCGGCCAGG - Exonic
1142335919 16:89489888-89489910 CCCGGCCACCCAGGCCCGCCCGG + Intronic
1142336019 16:89490114-89490136 CCCGACCCCCCAGGCCCGCCCGG + Intronic
1203062289 16_KI270728v1_random:986817-986839 CGGGGTCCCCCGGGCCGCCCGGG + Intergenic
1142623555 17:1179440-1179462 CCGCGCCCCCCAGACCAGCCCGG + Intronic
1142741627 17:1934942-1934964 CCTGGCCCTCCCAGCCGTCCTGG - Exonic
1142854995 17:2724385-2724407 CCGCGTCACCCCGGCCAGCCTGG + Intergenic
1143780315 17:9225712-9225734 CCGGCCCGCCCTGGCCCGCCCGG - Intronic
1144504492 17:15818298-15818320 CCCGGCCCCCGCAGCCCGCCAGG + Intergenic
1144656945 17:17042785-17042807 CCGGGAGCGCCAGGCCGGCCAGG + Exonic
1145168343 17:20633812-20633834 CCCGGCCCCCGCAGCCCGCCAGG + Intergenic
1145191554 17:20844349-20844371 CGGGGTCCCCCGGGCCGCCCGGG - Intronic
1146058775 17:29593773-29593795 CCGGGCACGCCCGTCCGGCCTGG + Intronic
1146164439 17:30576775-30576797 CCCGGCCCCCGCAGCCCGCCAGG + Intergenic
1146894951 17:36534505-36534527 CAGGCCGCCCCCTGCCGGCCAGG + Intronic
1147139604 17:38453818-38453840 CCGGGGCCCGCCGGCCGCCCGGG + Intronic
1147189397 17:38730135-38730157 CCCGGCGCCCCCTGCCGGGCGGG - Intergenic
1147613179 17:41813135-41813157 CAGGGGGCCCCCGGCCGGGCTGG - Exonic
1147728549 17:42582091-42582113 CCAGGCCCCACCTGCCAGCCGGG - Exonic
1148048681 17:44758990-44759012 CCCGGCCCCGCCGCCCCGCCGGG + Intergenic
1148080979 17:44967714-44967736 CCGGGCCCTCCGGGGCTGCCGGG - Exonic
1148081025 17:44967813-44967835 CCGGGCCGCACCGGCAAGCCCGG - Exonic
1148106461 17:45121372-45121394 CCGGGTCCTCCCGCCCCGCCAGG - Exonic
1148206775 17:45784373-45784395 CCCGGCCCCGCGGCCCGGCCCGG - Intronic
1148641636 17:49192401-49192423 CCGGGGCCCCACGGGCGGCGTGG - Intergenic
1148742098 17:49898688-49898710 CCAGGCCTCCCAGGCTGGCCAGG - Intergenic
1148782528 17:50129914-50129936 CGGGGGCCCCGCGTCCGGCCAGG - Intergenic
1148793591 17:50186903-50186925 CAGGGTCCCCCCGGCCCTCCTGG - Exonic
1148795864 17:50196348-50196370 CAGGGCCCCCGTGGCCTGCCTGG - Exonic
1148855305 17:50575938-50575960 CAGGGCCCCCCGGGCCAGCCCGG + Exonic
1149347201 17:55751006-55751028 CCGGGCTGCCCCGGCTGCCCCGG - Exonic
1151455378 17:74222624-74222646 CCCGGCCACCACGGCCGTCCAGG - Exonic
1151558773 17:74860105-74860127 CCAGGGCCCCCGGGCGGGCCTGG - Intronic
1151612168 17:75183150-75183172 GCGCGCCCCCGCGGCGGGCCGGG - Intergenic
1151625040 17:75271133-75271155 CCGGGACCCACCTGCCGGGCCGG + Exonic
1151655061 17:75491951-75491973 CCTGGCCTCCCTGGCCAGCCTGG + Intronic
1151660350 17:75515405-75515427 CCGGACCCCGGCGGGCGGCCGGG - Exonic
1151767612 17:76140342-76140364 CCCGGCCTCCTCCGCCGGCCCGG + Exonic
1152111364 17:78359354-78359376 CCGGGGCCACCCTGCCGGCAGGG - Intronic
1152125795 17:78445774-78445796 CAGGGCGCCCCCTGCAGGCCGGG - Intronic
1152306081 17:79520768-79520790 TCGGGCCCTCCCGGCTGGCCGGG + Intergenic
1152628515 17:81399388-81399410 CCCGGCCCCGCCACCCGGCCTGG + Intronic
1152641708 17:81452113-81452135 CCAGGCCCCCCCGCCACGCCAGG - Intronic
1152706188 17:81844798-81844820 CCGGGCCCCGCCAGCGGGCTGGG + Intronic
1152708860 17:81860292-81860314 CCGAGCCCCGCCCGCCCGCCAGG + Intronic
1152777680 17:82212919-82212941 CCGGCCCCTCCCGCCCCGCCGGG + Intergenic
1152817789 17:82418506-82418528 CCTGGCGCCCGCGTCCGGCCCGG - Exonic
1152987638 18:334807-334829 AAGGGCCCCCCCGGCCCTCCTGG - Exonic
1152987696 18:334960-334982 CCAGGCCCCCCGGGCCCACCAGG - Exonic
1153015646 18:580336-580358 TCGGGCGCCCCCCGCCGGCGCGG - Exonic
1153805449 18:8705822-8705844 CCGGCCCGCCGCGCCCGGCCCGG + Intronic
1153805729 18:8706742-8706764 CGGGGCGCCCCCGGAGGGCCTGG + Intronic
1154073082 18:11173026-11173048 GTGAGCCACCCCGGCCGGCCAGG - Intergenic
1154303998 18:13217801-13217823 GCGCGCCGCCGCGGCCGGCCGGG + Intronic
1155163927 18:23217947-23217969 CCGGGCTGCCCCAGCCTGCCGGG + Intronic
1157464203 18:47930530-47930552 CCGGGCCCGGCCGGCGGCCCGGG + Exonic
1157610102 18:48950613-48950635 CCGGGCCCCCGCGCGCGCCCCGG - Exonic
1157761367 18:50268141-50268163 CCGGGCCCGCCCGTCGGTCCGGG + Intronic
1157867129 18:51197025-51197047 CGGGCTCCGCCCGGCCGGCCCGG - Exonic
1158435866 18:57435455-57435477 CCGGGCCCCGCCGCTCGGGCCGG - Intergenic
1158976821 18:62716854-62716876 CCGGGCCAGCCCCGCCGTCCCGG + Exonic
1160025543 18:75212156-75212178 CCGGCCTCCCCCGGCCATCCGGG - Intronic
1160404809 18:78638127-78638149 GCAGGGCGCCCCGGCCGGCCTGG + Intergenic
1160453551 18:78980498-78980520 CCGGGGCCCCGCGGCCGGCCTGG - Intronic
1160703819 19:519884-519906 CCGGGCCCTCCAGCCCCGCCCGG + Intergenic
1160715113 19:572916-572938 CCGGGCTCCCCCGGGCGCTCCGG + Intronic
1160725516 19:616366-616388 CCGGGCCGCCGCGCCCAGCCCGG + Exonic
1160736097 19:663036-663058 CCGGGCCTCACCGGCAGGCGCGG + Exonic
1160736862 19:666966-666988 CCAGGCCCCACCGGCCACCCTGG + Intergenic
1160790461 19:920584-920606 CCCCGCCGCCCCCGCCGGCCCGG + Exonic
1160909777 19:1469152-1469174 CCGGGCCCCAGGGGCCGGGCGGG + Exonic
1160947792 19:1651797-1651819 GCGCCCCCCCCCGGCCCGCCCGG + Intronic
1161108747 19:2456836-2456858 GCGGGCCCGCCCGCGCGGCCGGG + Exonic
1161168250 19:2800075-2800097 CTTGGCCACCCCGTCCGGCCTGG - Intronic
1161171329 19:2813774-2813796 TCAGACCCCCCAGGCCGGCCTGG - Exonic
1161241421 19:3225557-3225579 CCGGACCTGCCCCGCCGGCCTGG - Intronic
1161376397 19:3941208-3941230 CAGGGTCCCCCCCGCCCGCCCGG - Intronic
1161398754 19:4058581-4058603 CCGAGAGCCACCGGCCGGCCTGG - Intronic
1161583576 19:5093374-5093396 CCTGCCCCTCCCGGCCAGCCAGG - Intronic
1161961860 19:7527719-7527741 CAGGGCCCCCCCGCCCGCGCTGG + Intronic
1162017097 19:7851767-7851789 CCTGGCCCTCCCGGCCCACCTGG - Exonic
1162315596 19:9936449-9936471 CAGGGTCGCCCCGGCCGGGCGGG - Exonic
1162395625 19:10416823-10416845 CAGGGCTCCCCCTGCCGGTCGGG - Intronic
1162776636 19:12983741-12983763 CCGCGCGCCCCCTGCTGGCCTGG - Intergenic
1162824906 19:13245313-13245335 CCCGGCCCCCTAGGCTGGCCGGG + Intronic
1162903431 19:13808988-13809010 CCGCGCCCCGCCGGCCCGCACGG - Intronic
1162911586 19:13850649-13850671 CCGGGCCCCTCCGGACGCCGAGG - Intergenic
1163158091 19:15449768-15449790 GCGGGCTCCCCAGGCCGGGCCGG + Intronic
1163314930 19:16535331-16535353 CAGGGCCCCCCCTGCCACCCAGG - Intronic
1163557535 19:18001180-18001202 CCGGGCCCCCCCGGCGAACTTGG - Intronic
1165154962 19:33781391-33781413 GCGGGGCCCCCCAGCCTGCCAGG - Intergenic
1165172855 19:33906101-33906123 CCGGCCCGCCCCGCCCCGCCCGG - Intergenic
1165415831 19:35692843-35692865 CCGCGCCCCCCCGCCCGGCTAGG - Intergenic
1165420060 19:35718079-35718101 CCGGCGCCCCGCGGCCGGCCCGG - Exonic
1165773309 19:38390412-38390434 GCGGGCCCCCCCCTCGGGCCTGG - Exonic
1165851391 19:38852053-38852075 CCCCGCCCCCGCGGCCGGCCCGG + Intronic
1166039114 19:40191589-40191611 CCCGCCACCCCCGCCCGGCCCGG + Intergenic
1166106731 19:40601333-40601355 CCGGGCCCCTCGGGCGGGCTGGG + Intronic
1166215327 19:41331015-41331037 CCGCCCCGCCCCGGCAGGCCCGG - Exonic
1166303814 19:41926692-41926714 CTGGGCCGCGGCGGCCGGCCGGG + Intronic
1166304204 19:41928420-41928442 CCCCGCGCCCCCAGCCGGCCAGG - Intronic
1166306844 19:41940231-41940253 CCGGGCTCCCCGCGCCCGCCAGG - Intergenic
1166329387 19:42069641-42069663 GTGGCCCCCCCAGGCCGGCCCGG - Intronic
1166765750 19:45251498-45251520 CCCCTCCCCCCCCGCCGGCCTGG - Exonic
1167134451 19:47608740-47608762 CCGGGTCCCGCCGCTCGGCCTGG + Intronic
1167251028 19:48398495-48398517 CCGGGCCCACCGGCCCCGCCCGG - Exonic
1167483444 19:49746602-49746624 CAGGGCTGCCCCGGCCCGCCAGG - Exonic
1168305491 19:55433101-55433123 CCGGGCCCCCCGTCCCAGCCTGG - Exonic
925992307 2:9263350-9263372 CAGGACCCCCCCAGCCAGCCTGG - Intronic
926718115 2:15940674-15940696 CCCCGCCCCCCCGGCCCACCCGG + Exonic
927168771 2:20350955-20350977 CAGGGCGCCCCCGGCCCGCGCGG - Intronic
927714036 2:25341410-25341432 CCGGGCCGCCCCCGCCTTCCGGG - Intronic
927714115 2:25341630-25341652 CCGCGCCGCCCCGGCCAGCCCGG + Intronic
927931801 2:27050188-27050210 CCGAACCCCCCGGGCCGCCCTGG - Intronic
927945733 2:27134212-27134234 CCGCGACCCCCCGGCCACCCTGG + Intronic
929188618 2:39120515-39120537 CGCGGCCCCACCGGACGGCCCGG + Intronic
929606816 2:43240244-43240266 CCAGGCCACCCCAGCCTGCCTGG - Intronic
929665642 2:43831904-43831926 CCTGGCCCCCCCGCCCGCCCCGG - Intronic
930011521 2:46941400-46941422 CCGGGCCCCCGCTGCCGCCCGGG + Exonic
931869639 2:66444652-66444674 CTTGGCCCCCGCGGGCGGCCCGG + Intronic
932699768 2:73984812-73984834 CCGAGCCCCGCCGGCCCGGCCGG - Intergenic
933876163 2:86623498-86623520 CCAGGCCCCGCCGACCGCCCAGG + Exonic
934031860 2:88055592-88055614 CCGGGCCGCCCCCGCCGCCGGGG + Intronic
934993391 2:98936522-98936544 CCGGTGCCCCCCGGCCCTCCCGG - Intergenic
935692653 2:105744983-105745005 CCGGGCGGACCCTGCCGGCCCGG - Exonic
937221500 2:120345295-120345317 CCGGCGCCCCGCGCCCGGCCGGG + Intergenic
937305030 2:120865853-120865875 CCGGGTACCCCAGGCAGGCCAGG + Intronic
937894704 2:126969845-126969867 CCGGGGCACCCCTGTCGGCCTGG - Intergenic
938018295 2:127885694-127885716 CCCGGCCCCGCCGCCCGCCCCGG + Intronic
938455648 2:131460912-131460934 GCGGACCCCCCAGGCGGGCCGGG + Intergenic
940316705 2:152335104-152335126 CCCGGCCCCCGCCCCCGGCCCGG - Intergenic
942292673 2:174487335-174487357 CCGGCCCCGCCCTGCCGGCTGGG + Intergenic
942965881 2:181891961-181891983 CCGGGGCCCCCTGCCCGGCCGGG + Exonic
943523594 2:188988078-188988100 CAGGGCCCCCCAGGCCCTCCCGG + Exonic
946360785 2:219218382-219218404 CAGTGCCCACCCGGCCAGCCAGG + Exonic
946360790 2:219218391-219218413 CCCGGCCAGCCAGGCCGGCCAGG + Exonic
946411988 2:219520078-219520100 CCTGGCCCCCCGGGGCTGCCTGG - Intronic
947399005 2:229714194-229714216 CCGGCCCCCGCCGGCGAGCCTGG - Exonic
948115749 2:235493771-235493793 GCGGGACCCTCCCGCCGGCCAGG - Intergenic
948487334 2:238289138-238289160 CTGCGCACCTCCGGCCGGCCTGG + Intronic
948767936 2:240233150-240233172 CCGGGCAGGCCCGGCCGGCAGGG - Intergenic
948883867 2:240873489-240873511 CCTTGGCCCCTCGGCCGGCCTGG - Intronic
949022694 2:241750374-241750396 CCGGGCACCCCCCGCCCACCCGG - Intronic
1169213035 20:3778181-3778203 CCGGGCGTCCCCGCGCGGCCCGG + Exonic
1169367204 20:5001311-5001333 CCGCGCCCACGAGGCCGGCCTGG - Intronic
1169483523 20:6006513-6006535 CCGGGCCCCACTGGCCGCCCGGG - Exonic
1171034732 20:21705944-21705966 CCCGGCCACCCCGGCCACCCCGG + Exonic
1171175634 20:23049450-23049472 CGGGGAACCCCAGGCCGGCCAGG + Exonic
1171446350 20:25207245-25207267 CCGGGCCCCCGGGGCTGCCCTGG - Exonic
1171972523 20:31573151-31573173 CGGGGGCCCCCCTGCCCGCCTGG - Intronic
1172118176 20:32583830-32583852 CCCCGTCCCCCGGGCCGGCCCGG - Intronic
1172128399 20:32639104-32639126 CCTGGCTCCCCTGGCTGGCCTGG + Intergenic
1172295913 20:33811277-33811299 ACAGGCCCCCACGCCCGGCCCGG - Intergenic
1172644562 20:36461651-36461673 GGGGGCCGCCCCGCCCGGCCCGG + Intronic
1172684874 20:36746005-36746027 CCGCGCGCCCCCCGCGGGCCGGG + Intronic
1172698659 20:36839258-36839280 CCGTGCCGCCCAGACCGGCCAGG - Exonic
1172841221 20:37903584-37903606 CGGGGCGCCCCCTGCCGGCGCGG + Intronic
1173222576 20:41141745-41141767 CCAGGCCCCCCCGCCCAGCTGGG + Intronic
1173243475 20:41317782-41317804 CCAGGCCCCCCAGTCCGCCCAGG + Intergenic
1173279837 20:41618250-41618272 CCGGCCCCGCCCCGCCGGCCGGG - Intronic
1173548195 20:43914939-43914961 CGGGGCCGAGCCGGCCGGCCTGG + Exonic
1173649128 20:44651794-44651816 CCCCGCCCCGCCCGCCGGCCTGG + Intronic
1173741549 20:45405975-45405997 TCTGACCCGCCCGGCCGGCCCGG + Intronic
1173865086 20:46308157-46308179 CCCGGCCGCTCCCGCCGGCCAGG + Intronic
1173894662 20:46541751-46541773 CAGGGCCCCCGCGGCCAGCGGGG + Exonic
1174287809 20:49484374-49484396 CCCGGCCTCCCCGGCAGGCTGGG - Intergenic
1174318969 20:49725669-49725691 CTGAGCCACCCCGCCCGGCCTGG + Intergenic
1174373961 20:50113066-50113088 CCATGCCCCCTCGGCCGGCCGGG + Intronic
1175268021 20:57714279-57714301 CCTGCCACCCCCGGCCTGCCTGG + Intergenic
1175928225 20:62481107-62481129 CCGGGCCCCACAGCCCTGCCAGG - Intergenic
1175958016 20:62621292-62621314 CCGATCCCCGCCGGCCAGCCTGG + Intergenic
1175997322 20:62817579-62817601 CCCGGCCCCCCCGGCCCCCCAGG + Exonic
1175997330 20:62817588-62817610 CCCGGCCCCCCAGGGCCGCCCGG + Exonic
1175997332 20:62817589-62817611 CCGGCCCCCCAGGGCCGCCCGGG + Exonic
1176005616 20:62861035-62861057 CCGAGCCCCCCGAGCCGGGCGGG - Exonic
1176039102 20:63055078-63055100 CCTGGCCCCTCCGGCTGCCCCGG - Intergenic
1176112308 20:63416198-63416220 CCCGGCCCCCTCGGCCTGCGAGG + Intronic
1176127766 20:63483572-63483594 GTGGGCCCCCGCGCCCGGCCGGG - Intergenic
1176221151 20:63969848-63969870 CCGCGCCCCCCGCCCCGGCCCGG - Intronic
1176231533 20:64035702-64035724 CCGGGCCCCCGCTGCTGGCCCGG - Intronic
1176232278 20:64038569-64038591 CACGGCCCCCGCGCCCGGCCCGG - Intronic
1176286807 21:5022843-5022865 CCACGCCCCGCCGGCCGCCCCGG - Intronic
1176547773 21:8208946-8208968 CCGGGCCCCACCCCCCGACCCGG - Intergenic
1176547825 21:8209079-8209101 CCGAGCCCCGCCGGCGGGCGCGG - Intergenic
1176549339 21:8214605-8214627 CCGGGCCTTCCCAGCCGTCCCGG - Intergenic
1176555669 21:8253151-8253173 CCGGGCCCCACCCCCCGACCCGG - Intergenic
1176557232 21:8258828-8258850 CCGGGCCTTCCCAGCCGTCCCGG - Intergenic
1176566718 21:8391985-8392007 CCGGGCCCCACCCCCCGACCCGG - Intergenic
1176574599 21:8436180-8436202 CCGGGCCCCACCCCCCGACCCGG - Intergenic
1176574652 21:8436314-8436336 CCGAGCCCCGCCGGCGGGCGCGG - Intergenic
1176576174 21:8441863-8441885 CCGGGCCTTCCCAGCCGTCCCGG - Intergenic
1176611212 21:8987472-8987494 CCGGGCCCCACCCCCCGACCCGG - Intergenic
1176611265 21:8987606-8987628 CCGAGCCCCGCCGGCGGGCGCGG - Intergenic
1178992516 21:37367350-37367372 GCGGGGCCGCACGGCCGGCCCGG - Intronic
1179209484 21:39313356-39313378 CCGGGCTCCCCCGGCTCCCCTGG - Intronic
1179833354 21:44012208-44012230 CCGGTCCCGCGCGGCCGGCCCGG + Intergenic
1179870374 21:44240632-44240654 CCACGCCCCGCCGGCCGCCCCGG + Intronic
1179905029 21:44418340-44418362 CGGGGCCCCCCCGGTGGGTCAGG + Intronic
1179922095 21:44512895-44512917 CCCGGCCCCCCAGGCCTGTCTGG - Intronic
1180014684 21:45074528-45074550 CCCGCCCCCGCCGGCCCGCCGGG - Intronic
1180078980 21:45477786-45477808 CCGGGCCCACCTGGCCGGGCAGG + Exonic
1180081166 21:45488415-45488437 CAGGGACCTCCCGGCCTGCCGGG + Exonic
1180081991 21:45491255-45491277 CCGGGCCTCCCTGGCCCCCCCGG + Exonic
1180081996 21:45491264-45491286 CCTGGCCCCCCCGGACCCCCGGG + Exonic
1180084988 21:45504500-45504522 CCCGGCCCCCCCGGCCCCCCAGG + Exonic
1180084995 21:45504509-45504531 CCCGGCCCCCCAGGCCCCCCAGG + Exonic
1180085207 21:45505215-45505237 CAGGGCCCTCCCGGCCCCCCAGG + Exonic
1180085211 21:45505224-45505246 CCCGGCCCCCCAGGCCCCCCAGG + Exonic
1180085262 21:45505378-45505400 CCGGGCCCCCCTGGGCCCCCTGG + Exonic
1180949382 22:19714393-19714415 CCCGCCCCCCCGGGCCGCCCTGG + Intergenic
1181045848 22:20213921-20213943 CGGGGGCCCCCAGGCCTGCCAGG - Intergenic
1181064395 22:20298877-20298899 CCGGACCCACCTGGCTGGCCTGG + Intergenic
1181672880 22:24433950-24433972 CCTGGCCCTCCCAGGCGGCCTGG + Intronic
1182296069 22:29311734-29311756 CCGGGCCCGCCGGGCAGGGCTGG - Intronic
1182418752 22:30238368-30238390 CCCTGCCCCTGCGGCCGGCCAGG - Intergenic
1182421553 22:30250989-30251011 CCGGGCACCCCCGGCTGCCCAGG + Intergenic
1182664003 22:31944425-31944447 CCGCTCCCCGCCGCCCGGCCTGG + Intronic
1183293868 22:37018939-37018961 CCCGCCCCTCCCAGCCGGCCCGG + Exonic
1183441462 22:37825345-37825367 TCGGGCCCACCCGGCTGCCCCGG + Exonic
1183601631 22:38843631-38843653 CCGGGCCCCCCGCGCTGCCCGGG - Exonic
1183702235 22:39457288-39457310 CCGGGCCCCCGCCGCCGCCCCGG + Intergenic
1183788437 22:40045312-40045334 CCGGGGCGCCCCGAACGGCCGGG + Intronic
1183856077 22:40636242-40636264 CCGCGCCCGCCCGCCCGGCCCGG + Intronic
1184101461 22:42343642-42343664 CCCGCGCGCCCCGGCCGGCCCGG + Intergenic
1184523779 22:45009799-45009821 CCGGGCCGCGCCGGCAGCCCGGG - Intronic
1184680696 22:46071075-46071097 CCGGCCCGCCCCCGCCGCCCTGG - Intronic
1185272380 22:49935318-49935340 CCGCGCCCCGCCGCCCGCCCGGG - Intergenic
1185296814 22:50058618-50058640 TCGGGCCCCCCAGGCCCGCCAGG + Intergenic
1203252647 22_KI270733v1_random:125231-125253 CCGGGCCCCACCCCCCGACCCGG - Intergenic
1203252699 22_KI270733v1_random:125364-125386 CCGAGCCCCGCCGGCGGGCGCGG - Intergenic
1203254224 22_KI270733v1_random:130921-130943 CCGGGCCTTCCCAGCCGTCCCGG - Intergenic
1203260703 22_KI270733v1_random:170317-170339 CCGGGCCCCACCCCCCGACCCGG - Intergenic
1203260756 22_KI270733v1_random:170451-170473 CCGAGCCCCGCCGGCGGGCGCGG - Intergenic
1203262280 22_KI270733v1_random:176000-176022 CCGGGCCTTCCCAGCCGTCCCGG - Intergenic
950518151 3:13480500-13480522 CCAGGCCCTCCCGGCGCGCCAGG + Intronic
950939977 3:16883599-16883621 CTGGGCCCCGCAGGCCGGCAGGG + Intronic
951803548 3:26623067-26623089 CCAAGCCCGCCGGGCCGGCCCGG + Exonic
951803547 3:26623067-26623089 CCGGGCCGGCCCGGCGGGCTTGG - Exonic
953027363 3:39152958-39152980 CCGGGCGCCCCCGGCCGGCGGGG - Intronic
953614396 3:44477483-44477505 CCGGGCCCCGTCCGCCGCCCGGG + Intronic
953627245 3:44581056-44581078 CCGGGAGCGCCAGGCCGGCCGGG - Intronic
954031760 3:47824943-47824965 CCGCGCGCCCCCTGCGGGCCGGG - Intronic
954133363 3:48570940-48570962 CTGGGCCTCCCTGGCCTGCCCGG - Exonic
954152088 3:48662714-48662736 CCGGGCCCCTGCCGCCGCCCCGG + Exonic
954411509 3:50373316-50373338 CCGGGCGCCCCCCACCTGCCTGG - Intronic
955575971 3:60363750-60363772 CCTGGCCCCCCTGGCCCCCCTGG + Intronic
957560182 3:81812271-81812293 GCCGGCCCACCCTGCCGGCCCGG - Intergenic
960556270 3:119034475-119034497 CCGGGCCCGCCGACCCGGCCTGG + Intronic
961202575 3:125056158-125056180 CCGGCCCCGCGCGGCGGGCCCGG + Intergenic
961539552 3:127590434-127590456 ACCGGCCGCCCCGGCCGCCCCGG + Exonic
961545428 3:127629583-127629605 GCGCGCCCCCCCGGCCCGCGAGG - Intronic
961665131 3:128489644-128489666 CCGGGCCTCCGCGGCCAGGCCGG + Intronic
961698991 3:128726748-128726770 CCGTGCCCACCCGGCGGGCATGG + Intronic
963038367 3:141051370-141051392 CCCCGCCTTCCCGGCCGGCCCGG - Intergenic
963732660 3:148987716-148987738 CCCCGCTCGCCCGGCCGGCCCGG + Intergenic
965520000 3:169662231-169662253 CCCGGCGCCCCCTGCCTGCCCGG - Intronic
965626896 3:170690601-170690623 CCTGGCCGGCCTGGCCGGCCTGG + Intronic
965626895 3:170690601-170690623 CCAGGCCGGCCAGGCCGGCCAGG - Intronic
966915827 3:184583715-184583737 CCGCGCCGCCGCAGCCGGCCCGG + Intronic
967055378 3:185825189-185825211 CCGCGCGCCGCCGCCCGGCCCGG - Intergenic
967859619 3:194141328-194141350 CCGGGGCCCTCCGCCCGGGCGGG + Intergenic
968092939 3:195909487-195909509 CCGGGGGCCCCCGACCGGCTCGG + Intronic
968126563 3:196164312-196164334 CCGTGCCCAGCCGGCCTGCCAGG - Intergenic
968136300 3:196221998-196222020 GTGAGCCCCCCCGCCCGGCCTGG + Intronic
968199544 3:196740227-196740249 CCGGGCCGCTCCCGCCCGCCAGG - Intronic
968452086 4:680595-680617 CCGGGCCGCCCTGGCCGCCCGGG - Intronic
968509014 4:987261-987283 CCGGGACCCCCTGGCCGCACGGG + Intronic
968547885 4:1207924-1207946 CCGGGCCACCCCGTCCCTCCTGG + Intronic
968599856 4:1503739-1503761 CCGGGCTCCCCCGGCTCCCCGGG + Intergenic
968615259 4:1574845-1574867 CTGGGCCTCCCCGGACGGACCGG + Intergenic
968659825 4:1794322-1794344 CCGCGCCCTCCCGACAGGCCAGG - Intronic
969156839 4:5218839-5218861 TCTGGCTCTCCCGGCCGGCCTGG + Intronic
969597836 4:8158898-8158920 CCGCGCCCCCGCTGCCGCCCGGG + Intergenic
969604914 4:8197639-8197661 CCAGGCTCCCCGGCCCGGCCTGG - Intronic
969716684 4:8871369-8871391 CCGCGCCTCCCCGCCGGGCCCGG + Exonic
970182579 4:13415492-13415514 CCCGGCCAGCCCTGCCGGCCCGG + Intronic
971351911 4:25862912-25862934 CCGCCCGCCCCCGGCCGGGCCGG + Exonic
974047481 4:56908983-56909005 CCGGGCCCCTCCGACCGCCCCGG - Intronic
976758531 4:88523773-88523795 CGGGGCCTGCCCGGCTGGCCTGG - Exonic
982564637 4:156971812-156971834 CCGGATCCTCCCGGCCGCCCCGG - Intergenic
983649707 4:170026207-170026229 GCGGGGGCCCCCGGCGGGCCGGG - Intronic
983923467 4:173371340-173371362 CTGGGCCCCCGGGGGCGGCCGGG + Exonic
985452630 4:190069719-190069741 CCGGGCCCCTGCAGCCGCCCAGG + Intergenic
985652115 5:1112086-1112108 CCGAGCCGCCCCGCCCCGCCCGG + Intergenic
985660793 5:1155752-1155774 CCGGGCCCCCGACCCCGGCCTGG - Intergenic
985716201 5:1463372-1463394 CCGGTGCCCCCCGCCCGGCAGGG + Exonic
985840424 5:2301328-2301350 CCATGCCCCCACGGCCTGCCTGG - Intergenic
986402840 5:7396196-7396218 CCGCGCCGCCTCGGCCGGCCCGG - Exonic
989043017 5:37248975-37248997 CCGGGGTCACCCGGCCGGCGTGG - Intronic
991703129 5:69333939-69333961 CATGGCCCCTCCGGCCAGCCAGG + Intergenic
992080610 5:73232475-73232497 CCGGGTCCCCTCCGCAGGCCAGG + Intergenic
992866275 5:80960383-80960405 CCGAGCCCCCGCGGCGGGCTGGG - Intergenic
993168387 5:84384680-84384702 GCGGGCTCCCGCGGCCGCCCCGG + Exonic
995787134 5:115842008-115842030 CAGTGCCCACCCGGTCGGCCCGG + Exonic
997297545 5:132777326-132777348 ACCGGCCTCCCCGCCCGGCCCGG + Exonic
997428418 5:133820206-133820228 CTGGACCCTCCCAGCCGGCCCGG - Intergenic
997899644 5:137753472-137753494 CCCGGCCGCCTCGGCCGCCCCGG + Exonic
998149272 5:139747639-139747661 GCCGGCCCCCACGTCCGGCCGGG - Intergenic
999259643 5:150230027-150230049 CCGAGCCCGCCCGGCCTGCCAGG - Intronic
1000014639 5:157266294-157266316 CCGAGCGCCCCCCGCGGGCCGGG - Intronic
1000351289 5:160354866-160354888 CAGGGCCCACCCGGCCCCCCAGG - Exonic
1001484583 5:172110645-172110667 CCGGCCCCCTCCTTCCGGCCAGG - Intronic
1001705016 5:173735299-173735321 CCAGGGCCCTCCTGCCGGCCTGG + Intergenic
1002139794 5:177132163-177132185 ACGGGACCGCCCGGCTGGCCGGG - Intergenic
1002140223 5:177133508-177133530 CCGGGGCCTACGGGCCGGCCCGG - Intronic
1002299160 5:178247782-178247804 CCTGGCCCCCCTGGCCCCCCAGG - Exonic
1002313594 5:178329417-178329439 CCAGGCTCCCCCTGCCAGCCAGG + Intronic
1002447264 5:179297322-179297344 CCCGGCCTCCCCTGCCTGCCTGG + Intronic
1002991895 6:2245818-2245840 CAGGCCCCCCACGGCCAGCCAGG - Intergenic
1003624058 6:7726941-7726963 CCCGGCATCCCCGCCCGGCCGGG - Exonic
1004044417 6:12011695-12011717 CCGGGTCTCCCCGGCGGGGCGGG - Intronic
1004908509 6:20259669-20259691 GCCGGCCCGCCCCGCCGGCCCGG + Intergenic
1005059271 6:21761257-21761279 CCGGGGCCCCAGGGCCGGTCAGG - Intergenic
1006083526 6:31580993-31581015 CCGGGCGCCCCCTGGCGGCGGGG - Exonic
1006147050 6:31965917-31965939 CCAGGCCCCTCCGCCCTGCCCGG - Exonic
1006174913 6:32115942-32115964 CCGGGGCCCCACGGCCTGACAGG + Exonic
1006298421 6:33180313-33180335 CAGGGCCCCCCTGGCCGAGCAGG - Exonic
1006898002 6:37483008-37483030 CCGGAACCCCCCAGCAGGCCAGG + Exonic
1007702230 6:43771935-43771957 CCGCCCTCCCCCGCCCGGCCGGG + Intronic
1007702235 6:43771944-43771966 CCGCGCGCACCCGGCCGGGCGGG - Intronic
1007702249 6:43771993-43772015 CCGGGAACACGCGGCCGGCCAGG - Intronic
1007784127 6:44270602-44270624 CCGGGCCCCCTCCCCCGGCGGGG + Exonic
1009935749 6:70232672-70232694 CCTGGTCCCCCCGGCCCTCCTGG - Exonic
1009939252 6:70270321-70270343 CCTGGCCCCCCTGGCCCCCCAGG - Exonic
1010369161 6:75087669-75087691 CCTGGCCCCCCTGGCCGTCCTGG - Exonic
1012550571 6:100461406-100461428 CCGGGCTCTCCCGGCCGGCTCGG + Intronic
1016340816 6:143060473-143060495 CCCCGCCCCCTCGCCCGGCCCGG + Intergenic
1018945626 6:168345669-168345691 ACAGCCCCCCCCGGCCGGCGGGG + Intergenic
1019298032 7:289519-289541 CCTGGACCCCCCGGCCGCTCTGG + Intergenic
1019482972 7:1274811-1274833 CCGGGCCACTCTGGACGGCCTGG + Intergenic
1019539788 7:1546465-1546487 CCGGGCGCCGCAGGCCGGCGGGG - Exonic
1019701200 7:2475716-2475738 CCGGGCCCCAGCGGCCGTACTGG + Exonic
1019989768 7:4682994-4683016 CCGGTAACCCCCGACCGGCCTGG + Intronic
1020002318 7:4762877-4762899 CCGGGCCTCCCCGGCAGCCTTGG - Exonic
1020080594 7:5283868-5283890 CCGCGCTCCTCCGGCCAGCCAGG - Intronic
1020105733 7:5421437-5421459 TGGGGCCCCTCCGGGCGGCCAGG + Exonic
1020204532 7:6104871-6104893 CCGCGCCCCTCCGGGCCGCCGGG - Exonic
1020264428 7:6551058-6551080 CCGGGCGCTTGCGGCCGGCCAGG + Exonic
1020274331 7:6615600-6615622 CCGCGCCCCCGCCCCCGGCCCGG + Exonic
1021653598 7:22854144-22854166 CCGGGCCCCGCGGGCGGGGCGGG + Intergenic
1021828010 7:24573643-24573665 CAGGGCGCCCCCGGCCGGCCCGG - Intronic
1022114374 7:27249473-27249495 CCAGGCCCTGCCGGCTGGCCGGG - Intergenic
1022207829 7:28180395-28180417 CCGGGGCTCCCCGCCCGGGCAGG + Intronic
1022375375 7:29806898-29806920 CCACGCCGCCCCGGCCGGGCCGG + Intronic
1023243734 7:38178379-38178401 CCGGCCGCCCCAGGCTGGCCCGG - Exonic
1023560657 7:41470243-41470265 CAGGGGCCCCCTGGCAGGCCTGG + Intergenic
1024043834 7:45574484-45574506 CCCGGCGCCCCGGGCCGGCGAGG + Intronic
1025198330 7:56948312-56948334 CCGCGCTCCTCCGGCCAGCCAGG + Intergenic
1025615512 7:63113589-63113611 GCGGGCCCCCAGGGCCGGCCTGG - Intergenic
1025673619 7:63628621-63628643 CCGCGCTCCTCCGGCCAGCCAGG - Intergenic
1025940960 7:66075978-66076000 CAGGGTCCCCCGGGCCGGGCTGG - Intronic
1027232974 7:76282697-76282719 CCGGGCGCGCACGGCCGGCGCGG + Exonic
1028477166 7:91265090-91265112 CCGGGCCCAGGCGGCGGGCCAGG + Exonic
1028987710 7:97021258-97021280 CGGGGCGCCCCGAGCCGGCCAGG - Intronic
1029359970 7:100081527-100081549 GCAGGGTCCCCCGGCCGGCCCGG - Intronic
1030278419 7:107744209-107744231 CCAAGCCCCCTTGGCCGGCCTGG + Intronic
1031052061 7:116954151-116954173 TCGGGCCTCCGCGGCCGGGCGGG - Intronic
1031629815 7:124032921-124032943 CCGGGGGCCCCTGGCGGGCCAGG - Exonic
1032092085 7:128916042-128916064 CAGGGCGCGCCCCGCCGGCCTGG - Intergenic
1032095855 7:128938260-128938282 CAGGGTGCGCCCGGCCGGCCTGG + Intronic
1033306690 7:140230656-140230678 CCGGCCCCGCCCGGCCGGCGTGG - Intergenic
1033662051 7:143408872-143408894 CCGCCCCCGCCCGGCCCGCCCGG - Exonic
1034129134 7:148699265-148699287 CCTGGCCGCCCCGGCCCGTCCGG - Intronic
1034440502 7:151083392-151083414 CCGCGCCCACCCCGCCGCCCAGG - Intronic
1034448613 7:151125935-151125957 CCGTGCGCAGCCGGCCGGCCGGG + Intronic
1034892492 7:154853599-154853621 CCTTGGCCCCCCTGCCGGCCTGG + Intronic
1034947214 7:155270123-155270145 CCCTGACCCCCCTGCCGGCCTGG - Intergenic
1035187716 7:157139168-157139190 CGGCGCCCGCCCGCCCGGCCCGG - Exonic
1036195399 8:6708977-6708999 CTGGGTCCGCCGGGCCGGCCGGG - Intronic
1036210188 8:6834980-6835002 CAGGGTCCCCCTGGACGGCCGGG + Intronic
1041072076 8:54135294-54135316 CCGGGCCCCACCGCCCTGCAAGG - Exonic
1047277364 8:123416457-123416479 CCGGGCCCCACCCACCAGCCGGG + Intergenic
1047381872 8:124372065-124372087 CCGCGCCCCGCCCGCCGTCCTGG - Exonic
1048072700 8:131039442-131039464 CTGGGCCATCCTGGCCGGCCTGG - Exonic
1048851515 8:138649735-138649757 CCTGGCCCCCCAGGCCTCCCTGG - Exonic
1049109446 8:140634482-140634504 CCTGGCTCTCTCGGCCGGCCTGG - Intronic
1049237157 8:141518168-141518190 CCGGCCCTCCCCGCCCTGCCGGG + Intronic
1049387194 8:142348992-142349014 CCAGGCCCCACCAGCCTGCCTGG + Intronic
1049406300 8:142453108-142453130 CGGAGCCCCCCTCGCCGGCCCGG + Intronic
1049419655 8:142511086-142511108 CGGCGCCCCTCCCGCCGGCCCGG - Intronic
1049463171 8:142739404-142739426 CCTGGCCCTCTCGGCCGGCCTGG - Intergenic
1049565243 8:143334774-143334796 CCGGGACACCCCGGGAGGCCGGG + Exonic
1049583064 8:143421465-143421487 CCCTGCTCCCCCGGCCGGGCGGG - Intronic
1049618962 8:143589266-143589288 CCGGGCACCCTCGGCCAGGCCGG + Exonic
1049620895 8:143597912-143597934 CGCGGGCCCCCCGGCCGGCCCGG + Exonic
1049676348 8:143890988-143891010 CCGGGCCCCTCCTGACGTCCTGG + Intergenic
1049746820 8:144266527-144266549 GCGGGCCTCGCGGGCCGGCCGGG - Intronic
1053129125 9:35605436-35605458 CCGGGCCCAGCCAGCCGGCGCGG + Intronic
1056413357 9:86354082-86354104 CAGGGTTCCCCCGGCCGGCCAGG + Intronic
1056922419 9:90802159-90802181 CCGGGCACCCCAGGGCGCCCAGG + Intronic
1057076622 9:92141506-92141528 CTGCGCCCCCCAGCCCGGCCCGG + Intergenic
1057313458 9:93955275-93955297 CCCTCCCCCGCCGGCCGGCCGGG + Exonic
1057592395 9:96383682-96383704 CTGGTCCCGCCCGGCCGGGCCGG + Exonic
1057773027 9:97984039-97984061 CCGCGCGCCCCGGGCCGGCCGGG + Intronic
1058053282 9:100427233-100427255 CGGCGCGCCCCCGGCCGGCCAGG - Intronic
1059145704 9:111897191-111897213 CCGGGCCGGTCCGGCGGGCCGGG + Exonic
1059145703 9:111897191-111897213 CCCGGCCCGCCGGACCGGCCCGG - Exonic
1060106470 9:120876422-120876444 CCGGGGGCCCCCGCCCGGCCAGG - Intronic
1060831837 9:126722381-126722403 CCAGGTCCCCGAGGCCGGCCCGG - Intergenic
1061008714 9:127942922-127942944 ACGGGCCCGCCTGGCCTGCCTGG + Exonic
1061101580 9:128496413-128496435 CTGGGCCCTCCTGGCAGGCCTGG - Intronic
1061677108 9:132223695-132223717 CTGGGCCCACCCGTCCCGCCTGG - Intronic
1061873896 9:133534601-133534623 CCCGCCCGCGCCGGCCGGCCTGG - Intronic
1061961692 9:133992045-133992067 CCGGGGCCCTCCCGCCCGCCGGG + Intronic
1062105004 9:134750539-134750561 CAGGGCCCCCCTGGACGCCCAGG + Exonic
1062117144 9:134815600-134815622 CCTGGCCCCCCCGGAGAGCCTGG + Exonic
1062146001 9:134989987-134990009 CAGGGCCACCCTGGCCAGCCTGG + Intergenic
1062399227 9:136365191-136365213 TCGGGCTCCCCCCGCCGGCAAGG + Exonic
1062421332 9:136484000-136484022 CCGGGCCGCCCCTCCCTGCCCGG - Exonic
1062460144 9:136659553-136659575 CCGGGCCCTCCCGGGCCTCCCGG - Exonic
1062469473 9:136696284-136696306 CCGGGGCCCCTCGGCGGGGCTGG - Intergenic
1062472684 9:136713211-136713233 CCGGGCCTCCCCTGCGGACCCGG - Intronic
1062504637 9:136866609-136866631 CCGGGCCCCGCACCCCGGCCGGG + Intronic
1062624852 9:137438131-137438153 CCCGGCCTCCCCTGCCGGCGGGG + Intronic
1062629237 9:137456255-137456277 CCTGGCCTCCCTGGCAGGCCTGG + Intronic
1203761007 EBV:13012-13034 CGGGGTCCCTCCGGCTGGCCTGG - Intergenic
1203761114 EBV:13306-13328 CGGGGTCCCTCCGGCTGGCCTGG - Intergenic
1203761936 EBV:16084-16106 CGGGGTCCCTCCGGCTGGCCTGG - Intergenic
1203762043 EBV:16378-16400 CGGGGTCCCTCCGGCTGGCCTGG - Intergenic
1203762865 EBV:19156-19178 CGGGGTCCCTCCGGCTGGCCTGG - Intergenic
1203762972 EBV:19450-19472 CGGGGTCCCTCCGGCTGGCCTGG - Intergenic
1203763794 EBV:22228-22250 CGGGGTCCCTCCGGCTGGCCTGG - Intergenic
1203763901 EBV:22522-22544 CGGGGTCCCTCCGGCTGGCCTGG - Intergenic
1203764723 EBV:25300-25322 CGGGGTCCCTCCGGCTGGCCTGG - Intergenic
1203764830 EBV:25594-25616 CGGGGTCCCTCCGGCTGGCCTGG - Intergenic
1203765652 EBV:28372-28394 CGGGGTCCCTCCGGCTGGCCTGG - Intergenic
1203765759 EBV:28666-28688 CGGGGTCCCTCCGGCTGGCCTGG - Intergenic
1203766581 EBV:31444-31466 CGGGGTCCCTCCGGCTGGCCTGG - Intergenic
1203766688 EBV:31738-31760 CGGGGTCCCTCCGGCTGGCCTGG - Intergenic
1203767510 EBV:34516-34538 CGGGGTCCCTCCGGCTGGCCTGG - Intergenic
1203767617 EBV:34810-34832 CGGGGTCCCTCCGGCTGGCCTGG - Intergenic
1203469050 Un_GL000220v1:108382-108404 CCGGGCCCCACCCCCCGACCCGG - Intergenic
1203469103 Un_GL000220v1:108516-108538 CCGAGCCCCGCCGGCGGGCGCGG - Intergenic
1203470625 Un_GL000220v1:114065-114087 CCGGGCCTTCCCAGCCGTCCCGG - Intergenic
1203476871 Un_GL000220v1:152354-152376 CCGGGCCCCACCCCCCGACCCGG - Intergenic
1203476924 Un_GL000220v1:152488-152510 CCGAGCCCCGCCGGCGGGCGCGG - Intergenic
1203478446 Un_GL000220v1:158037-158059 CCGGGCCTTCCCAGCCGTCCCGG - Intergenic
1186463406 X:9765850-9765872 CAGGACCCCGCCGGCCTGCCTGG + Exonic
1189001936 X:36957499-36957521 CCGGGCTCCCTCCGCGGGCCAGG + Intergenic
1189054591 X:37685796-37685818 GCGGGCCCGGCCGACCGGCCTGG - Exonic
1192584004 X:72306251-72306273 CCCGGCCCCGCTGGCCGGCAGGG + Intronic
1195221249 X:102746543-102746565 CCGGCTCCCCCCGGCCTTCCCGG - Intronic
1199772578 X:150983990-150984012 CCGCGCCCCCCCGGGCCACCGGG - Intronic
1200052956 X:153444521-153444543 CCGTGCTCTCCCGGCTGGCCTGG - Intergenic
1200100698 X:153688111-153688133 CCGCGCCCCCCGCCCCGGCCGGG - Exonic