ID: 1122582688

View in Genome Browser
Species Human (GRCh38)
Location 14:102781155-102781177
Sequence GGCCATCTGGTCCCTCTTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 126}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122582682_1122582688 7 Left 1122582682 14:102781125-102781147 CCCAGTGTCAGGAAAGCTCTGGT 0: 1
1: 0
2: 0
3: 11
4: 179
Right 1122582688 14:102781155-102781177 GGCCATCTGGTCCCTCTTACAGG 0: 1
1: 0
2: 0
3: 8
4: 126
1122582683_1122582688 6 Left 1122582683 14:102781126-102781148 CCAGTGTCAGGAAAGCTCTGGTA 0: 1
1: 0
2: 2
3: 7
4: 137
Right 1122582688 14:102781155-102781177 GGCCATCTGGTCCCTCTTACAGG 0: 1
1: 0
2: 0
3: 8
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122582688 Original CRISPR GGCCATCTGGTCCCTCTTAC AGG Intronic
900182723 1:1319412-1319434 GGCCATCTGCCCCATCTTGCTGG - Exonic
904093593 1:27961148-27961170 GGCCATCTCTGCCCTCTTGCTGG - Intronic
909371766 1:74891979-74892001 GACCATCTGGTCTCTCTTGGTGG - Intergenic
910224996 1:84927448-84927470 GGTCATCTGGTCCATCTAAGAGG + Intronic
913700076 1:121365833-121365855 CTCAAACTGGTCCCTCTTACTGG - Intronic
914137463 1:144914193-144914215 CTCAAACTGGTCCCTCTTACTGG + Intronic
917767851 1:178243307-178243329 GGCCATCTGGTGCCTCTAGGAGG + Intronic
920050799 1:203163685-203163707 GGGCATCTGGTTCCTCCCACTGG + Intronic
920487490 1:206384553-206384575 CTCAAACTGGTCCCTCTTACTGG - Intronic
920838434 1:209533733-209533755 GACTAACTGGTCTCTCTTACTGG - Intergenic
923223458 1:231917023-231917045 GGCCATCTACACCCTCTTTCGGG + Intronic
1063670719 10:8097607-8097629 GGCCACCTGGCCCGTCTTGCAGG + Intergenic
1067472687 10:46548094-46548116 AGCCCTCTGGTCCCTCACACGGG + Intergenic
1069622815 10:69848175-69848197 GGCCATCTGATCCATCTTCCTGG - Intronic
1074762534 10:116677584-116677606 GCCAGTCTGGACCCTCTTACTGG - Intronic
1075996448 10:126880286-126880308 GGGCATCTGCTACCTCTAACTGG + Intergenic
1084427630 11:69094284-69094306 GGCCATCAGGTTCCTCTCCCAGG + Intergenic
1085586527 11:77713012-77713034 GGAGCTCTGGTTCCTCTTACAGG + Intronic
1086804812 11:91227189-91227211 GCCCATCTGGTTTCTCCTACTGG + Intergenic
1090228680 11:125086586-125086608 GGTCATCTGGCCCCTCTGCCTGG + Intronic
1090986380 11:131770031-131770053 GGCCCTCTTCTCCCTCTCACTGG - Intronic
1100759081 12:97786360-97786382 GCCCATCTGGTCATTCTTATAGG + Intergenic
1102060418 12:109926852-109926874 GGACTTGTGGTACCTCTTACGGG + Intronic
1102408293 12:112693586-112693608 GCCCATCTGTTCCCTCTTCAAGG + Intronic
1103302435 12:119938234-119938256 TGCCATCTGGTGGCTGTTACTGG + Intergenic
1106860712 13:33904611-33904633 AGCCATCTGGTCCATTTTAAAGG - Intronic
1108552846 13:51563807-51563829 GGCTGGCTGGTCCCTCATACTGG + Intergenic
1109554280 13:63951083-63951105 GGACATCTGGTGTCTTTTACTGG - Intergenic
1111954042 13:94737626-94737648 TGACATCTGGGCCCTCTCACAGG + Intergenic
1112740920 13:102472212-102472234 GGACCTCTGGTCCCTCTTCTGGG - Intergenic
1112845742 13:103640981-103641003 AGCCATCTGCTCCCTCTCAAGGG - Intergenic
1113275603 13:108725985-108726007 GTACATCTGGTCTCTGTTACAGG + Intronic
1114586915 14:23823997-23824019 AACCATCTGGTCCCTATTCCTGG - Intergenic
1117864147 14:60127782-60127804 TGACATCTGTTCCCTCTTACAGG - Intronic
1120866491 14:89299673-89299695 GGCCACCTGGTCCCTCTCTGGGG - Intronic
1122582688 14:102781155-102781177 GGCCATCTGGTCCCTCTTACAGG + Intronic
1123991462 15:25686799-25686821 GGCCATGTGGTCCATCCTGCAGG + Intronic
1125230961 15:37454457-37454479 GGCCATGTGCTCCCTGTCACAGG - Intergenic
1125573953 15:40742359-40742381 GGCCATGTGGTCCCTCTCTTTGG - Intronic
1126675625 15:51157478-51157500 ACCCATCTGGTCCCTCACACAGG - Intergenic
1130303872 15:82699923-82699945 GGCCATCTGGTGACTGTGACAGG - Intronic
1130309706 15:82742546-82742568 GGCCATCTTGTCCCACCTAAGGG + Intergenic
1132311669 15:100862046-100862068 GGCCCTCTGGAGCCTCTTCCTGG - Intergenic
1132609374 16:807625-807647 CGCCAGCGGATCCCTCTTACAGG + Exonic
1135723541 16:24836938-24836960 GGCCATGTGGTCTCTGTCACAGG + Intergenic
1139434845 16:66930472-66930494 GGCCGTCTGGTCCCTGATAAGGG - Intergenic
1139846731 16:69926634-69926656 GGCCTTCTGGTCCTTCTGATTGG + Intronic
1146927860 17:36757415-36757437 GGACATCTGGACCCTCTCATGGG - Intergenic
1148806279 17:50265575-50265597 GGCCATATGGTCTCCCTTGCAGG - Intergenic
1150319569 17:64201249-64201271 AGCCACCTGGACCCTTTTACAGG - Intronic
1151167375 17:72217076-72217098 GGGCATCTGATCCTTCTTGCTGG - Intergenic
1152458748 17:80430592-80430614 GGCTCTCTGCTCCCTCTTCCTGG - Intronic
1152685866 17:81693658-81693680 GGCCGTCTCGTCCCTCTTGGGGG - Exonic
1155264433 18:24077160-24077182 GCCCATCTGCTCCTTCCTACTGG + Intronic
1156479925 18:37429982-37430004 GGCCAGCTAGTTCCTCCTACTGG + Intronic
1156835132 18:41543966-41543988 AGCCATCTGGTTCTTTTTACTGG + Intergenic
1163491633 19:17620316-17620338 GGCCATCTGGTCATTCCTAGAGG + Intronic
1167560296 19:50223010-50223032 GGCCCTCTGGTCCCTTACACTGG - Intronic
1168642850 19:58041306-58041328 GGCCAGCAGGTCCCTCCTAGAGG + Intronic
926449138 2:12981095-12981117 GGCCATCATGTCTCTCTCACTGG + Intergenic
928819148 2:35339868-35339890 TGACATCTGGTTCCTCTCACAGG - Intergenic
932214493 2:69958240-69958262 GACCATGTGGTGCTTCTTACTGG - Intergenic
933755215 2:85633038-85633060 GGCCATCTGGTCCCTCCCTCAGG - Intronic
935555320 2:104503330-104503352 GCCACTCTGTTCCCTCTTACTGG - Intergenic
936678604 2:114744734-114744756 GGCCATATGGTCACTGTTACAGG - Intronic
941567069 2:167122552-167122574 GGCAATCTGGCCTCTCTGACAGG + Intronic
942783255 2:179671318-179671340 TGCAATCTGGTCCCTCTTGAGGG + Intronic
1168988103 20:2068197-2068219 AGCCATCTTGTCCCACTTAAGGG + Intergenic
1172623236 20:36333169-36333191 GGCCATCTGGTCCCACTTTGAGG + Intronic
1172645967 20:36469837-36469859 GGCCATCTGCTCCTTCTCCCTGG + Intronic
1174599608 20:51713654-51713676 TGCCTGGTGGTCCCTCTTACTGG - Intronic
1175564933 20:59966714-59966736 GGCCTTGTGGACTCTCTTACAGG + Intronic
1178687662 21:34723877-34723899 GGACACCTGGTCCCTCTGGCTGG + Intergenic
1179674183 21:42970895-42970917 GGCCATGGGGGCCCTCTTCCCGG - Intergenic
1181496377 22:23289448-23289470 GGCCCTCTGGCCCCTCCCACTGG - Intronic
1182737697 22:32542883-32542905 GGCCAGCTGCTCCCTCCCACTGG + Intronic
1183933785 22:41250338-41250360 GGACATGTGGTGCCTCTTCCCGG - Intronic
949954330 3:9255418-9255440 GGCCATCTTTGCCATCTTACAGG - Intronic
952740246 3:36727700-36727722 GGCCATCTGGGGCCACTTTCTGG - Intronic
954718456 3:52539143-52539165 GGCCAACTGATGCCTCTAACTGG - Intronic
956005891 3:64777512-64777534 GGCCAACAGGTACCTCATACAGG + Intergenic
961319181 3:126061170-126061192 GGCCAGATGGTCATTCTTACAGG + Intronic
961778470 3:129307007-129307029 GGCCATCTGGCCCCTCTGCTTGG + Intergenic
966819491 3:183913799-183913821 GGCCACACGGTCCCCCTTACAGG + Intergenic
968659227 4:1792376-1792398 GGCCATCTGCTCCCACCTTCAGG - Intergenic
968977776 4:3830856-3830878 GGCCGTCTGGTCCCACTGCCTGG - Intergenic
975078118 4:70238809-70238831 GGCCATCTGGTGACTCCTATAGG - Intergenic
976036261 4:80824920-80824942 TGACATCTGGTCACTCTTTCTGG - Intronic
978249268 4:106610620-106610642 GGACATGTGGTTCCTCTTCCAGG + Intergenic
979707543 4:123738557-123738579 GGCAATCTCTTCCCTCTTAGGGG + Intergenic
988855089 5:35220573-35220595 GGATATCTGTTTCCTCTTACTGG + Intronic
988991041 5:36671271-36671293 CGCCATCCAGACCCTCTTACTGG + Intronic
994410596 5:99403034-99403056 GGCCATCAGGTACTACTTACTGG + Intergenic
994483236 5:100362235-100362257 GGCCATCAGGTACTACTTACTGG - Intergenic
997235380 5:132269367-132269389 GCCCATCTGGTCCCCATTAGAGG + Intronic
997672872 5:135690768-135690790 GGACATCTGGTTCCTGTTTCTGG - Intergenic
1000306173 5:159996599-159996621 GGCCATAATGTCCCTCTTCCAGG + Intergenic
1001482835 5:172100304-172100326 AGCCAGCCGGTGCCTCTTACTGG - Intronic
1006640950 6:35489609-35489631 GGGCATCTGGCCCCTCTGACAGG - Intronic
1006831514 6:36970903-36970925 CGGCAGCTGATCCCTCTTACCGG - Intronic
1007238218 6:40406166-40406188 TATCATCTGCTCCCTCTTACAGG - Intronic
1008044444 6:46837484-46837506 AGCCCTCTGGTTCCTTTTACTGG + Intronic
1012894275 6:104930991-104931013 GGACATTTGGTCCCTTTTCCTGG - Intergenic
1013103794 6:107009625-107009647 TGTCATCTAGTCCCTCTTGCTGG - Intergenic
1013222512 6:108091522-108091544 GGCCCTCTCTTCCCTCTTAATGG + Intronic
1014232115 6:118915418-118915440 GGCCATCTGAACCCTCTTTGGGG - Intronic
1016626035 6:146170760-146170782 TGACATCTGGTCCATCTCACAGG + Intronic
1017832306 6:158141617-158141639 GGAGATCTGGTTCTTCTTACAGG - Intronic
1018005469 6:159617943-159617965 GGGCATCTGGTCCATGTAACAGG - Intergenic
1019514867 7:1435146-1435168 GGCCATCTGGTCCCGTTTCAGGG - Exonic
1023166721 7:37350100-37350122 GGCCATCAGGTCCCTGATACGGG - Intronic
1024054961 7:45654129-45654151 GGCCACCGGCTCCCTCTTTCTGG - Intronic
1029582939 7:101449338-101449360 AGCCATCTGGTCCCCCCAACGGG + Intronic
1034719445 7:153275932-153275954 TGACATCTGGTCCCTTTCACAGG - Intergenic
1035689435 8:1550098-1550120 GGCCACATGGTCCCTCTCACGGG - Intronic
1038567829 8:28634567-28634589 GGTCATCTCTTCCCTCTTCCAGG - Intronic
1044722868 8:95167806-95167828 GGCCACCTGCTCCCGCTTAACGG + Intergenic
1047334122 8:123919888-123919910 GGCCACCTGCTCCCCCTTGCTGG - Intronic
1047544312 8:125800659-125800681 AGCCTGCTGGTCCCTCTTGCTGG + Intergenic
1049786983 8:144455762-144455784 GGCCACCTGGCCTCTCTTCCTGG + Intronic
1056738197 9:89227495-89227517 GGCCATCAGGTCCCTGTTGGAGG - Intergenic
1057261269 9:93586155-93586177 GGCCATGGGGTCCCTCTCCCCGG - Intronic
1060042420 9:120310757-120310779 AGCCCTCTGCTCCCTCTAACTGG + Intergenic
1061456034 9:130698429-130698451 TGCCAACTGCTCCCTCTTTCGGG - Intronic
1062678633 9:137763792-137763814 CGCCACCTGGCCCCTCTCACGGG - Intronic
1190076668 X:47322082-47322104 GGCCACCTGGTCCCATTTAGAGG + Intergenic
1190372250 X:49753869-49753891 AGCCATCTGGTCTCTCTACCTGG + Intergenic
1192773329 X:74216305-74216327 TGCCATCTGTTCCCTCTTTTGGG - Intergenic
1195627336 X:107017858-107017880 GGACATCTGGTCCATATTGCTGG - Intergenic
1196120031 X:112040012-112040034 GGCCATCTGGTCCCCCATGAAGG - Intronic
1199547283 X:149019421-149019443 GTCTGTCTGGTCCCTCTCACTGG + Intergenic
1202167956 Y:22012940-22012962 GGACATCTGGCCTCTCTTTCAGG - Intergenic
1202223405 Y:22573428-22573450 GGACATCTGGCCTCTCTTTCAGG + Intergenic
1202319710 Y:23622232-23622254 GGACATCTGGCCTCTCTTTCAGG - Intergenic
1202551058 Y:26047824-26047846 GGACATCTGGCCTCTCTTTCAGG + Intergenic