ID: 1122588110

View in Genome Browser
Species Human (GRCh38)
Location 14:102825347-102825369
Sequence CCTTGCTGCCCTTAATCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 1, 2: 0, 3: 10, 4: 119}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122588101_1122588110 20 Left 1122588101 14:102825304-102825326 CCACCTTCACAGGCCTGCGGGGA 0: 1
1: 0
2: 2
3: 23
4: 265
Right 1122588110 14:102825347-102825369 CCTTGCTGCCCTTAATCAGATGG 0: 1
1: 1
2: 0
3: 10
4: 119
1122588102_1122588110 17 Left 1122588102 14:102825307-102825329 CCTTCACAGGCCTGCGGGGACCT 0: 1
1: 0
2: 2
3: 21
4: 150
Right 1122588110 14:102825347-102825369 CCTTGCTGCCCTTAATCAGATGG 0: 1
1: 1
2: 0
3: 10
4: 119
1122588106_1122588110 -10 Left 1122588106 14:102825334-102825356 CCCGTGCACCAAACCTTGCTGCC 0: 1
1: 0
2: 0
3: 17
4: 166
Right 1122588110 14:102825347-102825369 CCTTGCTGCCCTTAATCAGATGG 0: 1
1: 1
2: 0
3: 10
4: 119
1122588105_1122588110 -3 Left 1122588105 14:102825327-102825349 CCTGGCACCCGTGCACCAAACCT 0: 1
1: 0
2: 0
3: 4
4: 90
Right 1122588110 14:102825347-102825369 CCTTGCTGCCCTTAATCAGATGG 0: 1
1: 1
2: 0
3: 10
4: 119
1122588104_1122588110 7 Left 1122588104 14:102825317-102825339 CCTGCGGGGACCTGGCACCCGTG 0: 1
1: 0
2: 1
3: 7
4: 136
Right 1122588110 14:102825347-102825369 CCTTGCTGCCCTTAATCAGATGG 0: 1
1: 1
2: 0
3: 10
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122588110 Original CRISPR CCTTGCTGCCCTTAATCAGA TGG Intronic
901062069 1:6476132-6476154 CCTTGCTACCTTTAATCTGGGGG - Intronic
902136786 1:14313558-14313580 CTTTGCTGCCCTAAATTCGATGG + Intergenic
904616012 1:31750290-31750312 CCATGCTGCTCTTGTTCAGAGGG + Intronic
905742381 1:40383406-40383428 CCTTGCTCCGCTTGATCACAGGG - Intronic
905889916 1:41512627-41512649 GCTGGCTGCCCTAAATCAGCTGG - Intronic
908356550 1:63329024-63329046 CCTTGCTGCCCTCCAACAGTTGG + Intergenic
909412463 1:75371130-75371152 CCTTGCTGCACGTAAAGAGATGG - Intronic
915836220 1:159177692-159177714 CCTTTCTGCAGTTGATCAGATGG - Intronic
918837022 1:189479621-189479643 CCCTCATGCCCTTATTCAGATGG + Intergenic
921624621 1:217364718-217364740 CCCTGCTTCCCTCAGTCAGAGGG + Intergenic
1068200812 10:53781907-53781929 CCTTGCTGCCATAAGTGAGATGG + Intergenic
1069928084 10:71865214-71865236 CCTTGGTGTCCTCATTCAGAAGG + Intergenic
1073608148 10:104916253-104916275 ACTTTCTACCCTGAATCAGATGG + Intronic
1075335296 10:121604544-121604566 TTTTGCTGCCATTAACCAGAGGG - Intergenic
1076052880 10:127349269-127349291 CCTGGCTGCCCCCAAGCAGATGG + Intronic
1076188297 10:128465663-128465685 CCTTTCTGCCCTCTTTCAGAGGG + Intergenic
1076355270 10:129848132-129848154 CTTTGCTTCCCTTAAAAAGATGG + Intronic
1083843526 11:65317536-65317558 CCATGCTGCCCTTACTCACTGGG + Intronic
1083871219 11:65489632-65489654 CCCTGCTGCCCTTACTCTGGGGG - Intergenic
1089317710 11:117603303-117603325 CCTTGCTATCCTGAATCAAATGG + Intronic
1103018248 12:117512888-117512910 CCTTGCTGCCCATAGGCAGAAGG + Intronic
1107739070 13:43429683-43429705 CCTTGCTGCCCTTCCTAACATGG - Intronic
1107836804 13:44418199-44418221 GCTTGCTGCCCTTATTTAGTGGG + Intergenic
1108641371 13:52385518-52385540 CCTTACTGCCCCTACCCAGAGGG - Intronic
1112050919 13:95643571-95643593 TCTTGATGCTCTTAAACAGATGG - Intronic
1117042090 14:51776727-51776749 CATTGCTGCCTTTCATCTGAGGG + Intergenic
1120109862 14:80541015-80541037 GCTGCCTGTCCTTAATCAGAAGG - Intronic
1122588110 14:102825347-102825369 CCTTGCTGCCCTTAATCAGATGG + Intronic
1128618471 15:69128844-69128866 CCCTGCTCCCATTAGTCAGAAGG - Intergenic
1128694145 15:69747756-69747778 CCTTGCTGCCCTTTAGCTGAGGG + Intergenic
1128694278 15:69748633-69748655 CCTTGCTCCCCCAAACCAGATGG + Intergenic
1129661895 15:77557414-77557436 CCTTGCTGGCCTTATCAAGAAGG - Intergenic
1133464183 16:6014292-6014314 CCTTCATCCCCTTAATAAGATGG - Intergenic
1133816887 16:9204292-9204314 CCTGGCTCCCCTTCATCAGCTGG + Intergenic
1134347581 16:13405280-13405302 CCTTCATGCCCTTAATTACATGG + Intergenic
1138279808 16:55764178-55764200 CCATGATGCCCGCAATCAGAAGG + Intergenic
1138288689 16:55829470-55829492 CCATGATGCCCGCAATCAGAAGG - Intronic
1138624937 16:58243954-58243976 CCTAACTCCCCCTAATCAGAGGG + Intronic
1138727515 16:59156388-59156410 CCTTGTTACCCTTGATCAAAGGG - Intergenic
1143703013 17:8675442-8675464 GGTTGCTGCTCCTAATCAGAAGG + Intergenic
1145285938 17:21506071-21506093 CCTTGCTCCCCCTAGCCAGAGGG + Intergenic
1145391661 17:22460229-22460251 CCTTGCTCCCCCTAGCCAGAGGG - Intergenic
1147430292 17:40366725-40366747 TCCTGCTGCCCTTCTTCAGAGGG - Intergenic
1148129641 17:45255119-45255141 CCTTGCTTCCCTGCAGCAGAGGG + Exonic
1148165197 17:45478878-45478900 CCTAGCTGCCAGTAACCAGATGG + Intronic
1148249499 17:46063317-46063339 CCTGGCTGCCCTGAATAATACGG + Intronic
1150412505 17:64957521-64957543 ACATGTTGCCCTTAATCAAATGG - Intergenic
1152031658 17:77846750-77846772 CCCTGCTACTGTTAATCAGAGGG + Intergenic
1153961550 18:10144290-10144312 CCCTGCTGTCCTTCCTCAGATGG + Intergenic
1154256018 18:12781508-12781530 CCTTGCTGCCCTTACAGATAAGG - Intergenic
1159027388 18:63196671-63196693 CCGTGCGGCCCTTTATCATACGG + Intronic
1160245082 18:77151928-77151950 GCTTGCTGACCTTAGCCAGAAGG + Intergenic
1160751606 19:737047-737069 CCTTGCTGCCTTTTCTGAGACGG - Intronic
927668067 2:25045888-25045910 GCTGGCTGCCCTAATTCAGAGGG - Intronic
930773248 2:55148851-55148873 CCTTCCTGCCTTTACTCAAATGG - Intergenic
932493347 2:72134796-72134818 CCTTGCTGCTCTCAATGAGGAGG + Exonic
932738319 2:74271694-74271716 TCTTGCTACCCTCAAGCAGAAGG - Intronic
934659236 2:96134344-96134366 CCAGGGTGCCCTGAATCAGAAGG + Intronic
935078681 2:99770887-99770909 CCCTCCTGTCCTTAAGCAGAAGG + Intronic
936598081 2:113868565-113868587 CCTGACTGCTCTTAAGCAGAAGG - Intergenic
944752520 2:202725069-202725091 CCTTGCTGCCCATAATATCAAGG - Intronic
945207714 2:207349669-207349691 CCTTGTAGCCCTTTGTCAGATGG - Intergenic
946610551 2:221453396-221453418 CCTTGCTTCCCACCATCAGATGG + Intronic
1170142201 20:13136145-13136167 CCTCTCTGCCCTTAAACTGAAGG + Intronic
1170775218 20:19369258-19369280 CTGTGCTGCCCTTCATCAGGAGG - Intronic
1171456376 20:25275035-25275057 CCTGCCTGCCCTTAAGCAGCGGG - Intronic
1174065606 20:47862754-47862776 CCTTGGAGACCTTGATCAGAGGG - Intergenic
1176094721 20:63335197-63335219 TGTAGCTGCCCTTCATCAGAAGG + Intergenic
1180982433 22:19885141-19885163 CCTTTCTCCCCTAACTCAGATGG + Intronic
1182863024 22:33577436-33577458 CCTTTCTGAATTTAATCAGAAGG + Intronic
1183707704 22:39484696-39484718 CCTTGCTGTCCTTAAAAAGTAGG + Intronic
1184223367 22:43114890-43114912 CCCTCCTGCCCTTTAACAGAAGG + Intronic
950496720 3:13338236-13338258 CCTGGCTGCCCTCAAGCAAAAGG + Intronic
951243913 3:20317885-20317907 CCTTGATGCCCTCAACCTGAGGG + Intergenic
955870527 3:63433684-63433706 CCTTGCAGCCCTGAATCCGAGGG + Intronic
956488712 3:69748766-69748788 CAATGATGCCCTTAATCACATGG - Intronic
956649243 3:71488456-71488478 CCTTCCTGCCCATAAGCAGCAGG - Intronic
958765207 3:98359988-98360010 CCTTGCTTTCCTCAAACAGATGG + Intergenic
960186431 3:114646231-114646253 CCTTGATGCCCTCACTCAGTAGG + Intronic
961689964 3:128662276-128662298 CCCTGCAGCTCTTAGTCAGAAGG + Intronic
963601992 3:147386837-147386859 CCTTTCTGCCGTTAATAAGAAGG - Exonic
968113468 3:196069799-196069821 CCATGCTGCCTTTCATCTGAAGG + Intronic
970882178 4:20945192-20945214 GATTGCTGCCCTGAATCAGTAGG - Intronic
975366927 4:73540387-73540409 CCTTTCAGCCCTTATTCAAATGG - Intergenic
977742207 4:100499488-100499510 CTTTTCTGCCCTGAATTAGATGG + Intronic
977918217 4:102616550-102616572 CCTTCCTGCCCATAATCATGGGG - Exonic
978350957 4:107820154-107820176 CTTTGTTGACCTTAACCAGAGGG - Intergenic
979500197 4:121431292-121431314 CTTTGTTGCCCTTAGCCAGAAGG - Intergenic
982081159 4:151791584-151791606 GCTTGCTGCAGTTAGTCAGAAGG + Intergenic
982798020 4:159668672-159668694 CCTGGTTGCCTTTAGTCAGAGGG + Intergenic
995153252 5:108877351-108877373 CTTTGTTTCCCTTAATCAAACGG - Intronic
997823589 5:137087183-137087205 CCCTGCTGCAGTTCATCAGATGG - Intronic
998760726 5:145429053-145429075 CCTGGGAGCCCTTAAGCAGAGGG + Intergenic
1001298257 5:170514398-170514420 CCTTGCTGCCCTGATTTCGATGG - Intronic
1003072468 6:2956091-2956113 CCTTCTGGCCTTTAATCAGATGG - Intronic
1004389536 6:15198497-15198519 CTTTGCTGCCCTGAATCACAAGG + Intergenic
1005332623 6:24764455-24764477 CCTTGCTGTCCTCACTCTGAAGG - Intergenic
1007965829 6:46002928-46002950 AATTGCTGCGCTAAATCAGAAGG - Intronic
1012488118 6:99744856-99744878 CCTTGAGGTTCTTAATCAGAAGG + Intergenic
1013386403 6:109636035-109636057 CCTTGCTGCCCTTTATTCAATGG - Intronic
1017375760 6:153766201-153766223 CCGTGGTGCTCTAAATCAGAGGG - Intergenic
1017721700 6:157247548-157247570 CCTTGCTACCCTCAACCAGAAGG - Intergenic
1018356507 6:163022862-163022884 CCTTTCTGCTCTTAATAGGATGG - Intronic
1018587814 6:165382260-165382282 CCTTCCAGCCCTTAATCATAAGG + Intronic
1024254935 7:47533471-47533493 CCTTGCTGATGTTAATCAAAGGG + Intronic
1024816164 7:53274603-53274625 CCTTGCTACCCTTAATTTGGTGG + Intergenic
1030634338 7:111931519-111931541 CCTTCCTGAAGTTAATCAGAAGG + Intronic
1032267888 7:130381336-130381358 CCTTGCTGCCCTTGAGCACCTGG + Intronic
1032325394 7:130923895-130923917 CCTGGCTGCTTTTAGTCAGAAGG + Intergenic
1033115477 7:138620959-138620981 CCGTTCTGCCTTTAATCTGAAGG + Intronic
1034433781 7:151053564-151053586 CCTTGCTCCCCTCACTCTGAGGG + Intergenic
1036948871 8:13121947-13121969 CCTGGCTGCCTTTAAACTGAGGG - Intronic
1039341814 8:36658727-36658749 CCTTGCTGCTGTGAAGCAGAGGG - Intergenic
1041461313 8:58114907-58114929 CCTTGCTGCCCTTCATCAGAGGG - Intronic
1041810049 8:61897674-61897696 CTTTACAGCACTTAATCAGAGGG + Intergenic
1044678687 8:94755376-94755398 CCTCCCTTCCCTTAACCAGATGG - Intronic
1044739296 8:95309349-95309371 GCTTGCTGCTGTTGATCAGAGGG + Intergenic
1045635215 8:104178295-104178317 CCTTGCTGCCTGTAAGCTGAGGG + Intronic
1045664895 8:104473661-104473683 CATTGTTGCCCTTAAACAAAAGG + Intergenic
1047524127 8:125617964-125617986 CCTTCCTGCCCATGGTCAGAGGG + Intergenic
1049105266 8:140608792-140608814 CCTTGCTGCCCTGGAGCAGCTGG - Intronic
1049386640 8:142346056-142346078 CCTTGCTGGCATTCAGCAGAAGG - Intronic
1057694504 9:97313689-97313711 CCATTCTGCCCTTCATCAGAAGG - Intronic
1058004382 9:99900314-99900336 CCTTCCTACCCTTGACCAGAGGG - Intergenic
1058345902 9:103961888-103961910 TTTTTCTGCCCTTAATCAGAGGG - Intergenic
1060039038 9:120283901-120283923 TCTTCCTGCCCTCCATCAGAAGG - Intergenic
1061572516 9:131486485-131486507 CCTTTCTTCTCTTCATCAGAAGG - Intronic
1187933778 X:24316546-24316568 CCCTGCTGCCGTTAATTAGAGGG + Intergenic
1188886141 X:35551939-35551961 CCCTGTAGCCCTCAATCAGATGG - Intergenic
1189275957 X:39786320-39786342 CCTTTCTGCCAATAATTAGATGG + Intergenic
1199317324 X:146395794-146395816 CTTTGCTGAACTCAATCAGAAGG + Intergenic