ID: 1122588535

View in Genome Browser
Species Human (GRCh38)
Location 14:102827992-102828014
Sequence CCGGGCTCAGGTACGCCCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 119}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122588535 Original CRISPR CCGGGCTCAGGTACGCCCTG CGG (reversed) Intronic
900120116 1:1045273-1045295 CTGAGCTCAGGTACTCACTGGGG - Exonic
900494854 1:2971787-2971809 CAGGGCCCAGGGACGGCCTGGGG - Intergenic
900610285 1:3541802-3541824 CCGGGCACAGGGGCTCCCTGGGG + Intronic
902411208 1:16212539-16212561 CAGGGCTCCGGGACACCCTGGGG + Exonic
907704259 1:56819401-56819423 CTGGGCTCAGGTGTGTCCTGTGG - Intronic
912827044 1:112915123-112915145 ACTGGCTCAGCTAAGCCCTGAGG + Intronic
916040195 1:160954930-160954952 CCAGGCTCAGGTACCCTCAGAGG - Intergenic
918783446 1:188732368-188732390 TCGGGCTCAGGCAGGTCCTGAGG - Intergenic
919658835 1:200223381-200223403 CCAGGCTGTGGTAAGCCCTGGGG + Intergenic
921274668 1:213507256-213507278 GCGTGCTCAGGTTGGCCCTGCGG - Intergenic
923391197 1:233515529-233515551 CCGGGCTCAGGGGAGGCCTGAGG - Intergenic
1067336875 10:45373856-45373878 CCAGGCTCCTGTAGGCCCTGGGG - Intergenic
1074361217 10:112825310-112825332 CTGGGCACAGGCACACCCTGTGG + Intergenic
1075291348 10:121233673-121233695 CCGGGAGCAGGGACTCCCTGAGG - Intergenic
1077043296 11:533956-533978 CAGGGCTCAGGGACCCCCTCAGG + Intronic
1077459160 11:2700178-2700200 CCGGGCTCAGATTGGCCCAGCGG + Intronic
1084517477 11:69644557-69644579 CCGGGCTCAGCTGAGCCCTGAGG + Intronic
1089213837 11:116823591-116823613 CCGGGCTCATGGGCTCCCTGAGG - Intergenic
1090330168 11:125925158-125925180 CCGTGCTCAGCTCCGCCTTGGGG + Intergenic
1090566082 11:127993533-127993555 CCAGGCTCAGAAACTCCCTGGGG - Intergenic
1090635446 11:128688050-128688072 CCGGGCTCGGGTACTCCGAGTGG - Intronic
1092748242 12:11693581-11693603 TCGGACTCAGGAACGGCCTGTGG + Intronic
1101409560 12:104457323-104457345 CCGGGCTCCGGTCCGCGCGGCGG + Exonic
1102238698 12:111310367-111310389 GCGGGCTCAGGACCGCCCAGTGG - Exonic
1104981946 12:132577159-132577181 CCAGGCCCAGGTCCACCCTGGGG - Intronic
1106377381 13:29202980-29203002 CGGGGGTCAGGGACCCCCTGAGG + Intronic
1113938735 13:114007822-114007844 CCGGGCTCAGGCAACACCTGGGG + Intronic
1114253851 14:20985039-20985061 CCCGGCCCATGTAGGCCCTGGGG - Intergenic
1115750540 14:36485307-36485329 CCTGGCTCAGGGATGCCCTATGG - Intronic
1118816035 14:69314599-69314621 GCAGGCTCAGGGAGGCCCTGTGG + Intronic
1122588535 14:102827992-102828014 CCGGGCTCAGGTACGCCCTGCGG - Intronic
1123008856 14:105337695-105337717 GGGGGCTCAGGTGGGCCCTGGGG - Intronic
1129191828 15:73941943-73941965 CCGGGCTCTGGCACATCCTGGGG + Intronic
1131257985 15:90873987-90874009 CCCAGCTCACGTAGGCCCTGGGG - Intronic
1135585774 16:23669770-23669792 CCAGGCTCAGGTACCCCCAGTGG - Exonic
1137439813 16:48488773-48488795 CCGGGCTCAGGCAGGCACAGTGG + Intergenic
1139430187 16:66907022-66907044 CCTGGCTCAGGTACCCCCACTGG - Intergenic
1141933094 16:87218096-87218118 CGGGGATCAGGTACGTGCTGGGG - Intronic
1141994211 16:87626560-87626582 CCGGGCTCAGGCAGGCCCATGGG - Intronic
1142010735 16:87712535-87712557 ACAGGCTCAGGGCCGCCCTGCGG + Intronic
1142898911 17:3000410-3000432 CCGGCATCAGGAAGGCCCTGAGG - Intronic
1142898932 17:3000509-3000531 CCGGCATCAGGAAGGCCCTGAGG - Intronic
1142898953 17:3000608-3000630 CCGGCATCAGGAAGGCCCTGAGG - Intronic
1142898972 17:3000707-3000729 CCGGCATCAGGAAGGCCCTGAGG - Intronic
1142898992 17:3000806-3000828 CCGGCATCAGGAAGGCCCTGAGG - Intronic
1142899013 17:3000905-3000927 CCGGCATCAGGAAGGCCCTGAGG - Intronic
1142899031 17:3001004-3001026 CCGGCATCAGGAAGGCCCTGAGG - Intronic
1142899050 17:3001103-3001125 CCGGCATCAGGAAGGCCCTGAGG - Intronic
1142899070 17:3001202-3001224 CCGGCATCAGGAAGGCCCTGAGG - Intronic
1142899089 17:3001301-3001323 CCGGCATCAGGAAGGCCCTGAGG - Intronic
1142899107 17:3001400-3001422 CCGGCATCAGGAAGGCCCTGAGG - Intronic
1142899125 17:3001499-3001521 CCGGCATCAGGAAGGCCCTGAGG - Intronic
1142899143 17:3001598-3001620 CCGGCATCAGGAAGGCCCTGAGG - Intronic
1146844013 17:36172444-36172466 CCGGGCTCTGGTCCTCACTGGGG - Intronic
1146856316 17:36260379-36260401 CCGGGCTCTGGTCCTCACTGGGG - Intronic
1146864300 17:36327996-36328018 CCGGGCTCTGGTCCTCACTGGGG + Intronic
1146872226 17:36384290-36384312 CCGGGCTCTGGTCCTCACTGGGG - Intronic
1146879587 17:36435375-36435397 CCGGGCTCTGGTCCTCACTGGGG - Intronic
1147067159 17:37928584-37928606 CCGGGCTCTGGTCCTCACTGGGG + Intronic
1147075112 17:37984914-37984936 CCGGGCTCTGGTCCTCACTGGGG - Intronic
1147078691 17:38008145-38008167 CCGGGCTCTGGTCCTCACTGGGG + Intronic
1147086637 17:38064460-38064482 CCGGGCTCTGGTCCTCACTGGGG - Intronic
1147094629 17:38132080-38132102 CCGGGCTCTGGTCCTCACTGGGG + Intergenic
1147102580 17:38188423-38188445 CCGGGCTCTGGTCCTCACTGGGG - Intergenic
1148491235 17:48025176-48025198 CCGGAGTCGGGTCCGCCCTGGGG + Intergenic
1149847155 17:60014890-60014912 CCGGGCTCTGGTCCTCACTGGGG - Intergenic
1150085514 17:62271507-62271529 CCGGGCTCTGGTCCTCACTGGGG - Intergenic
1155209156 18:23586253-23586275 CCGGCCACCGGGACGCCCTGTGG - Intronic
1159941985 18:74415285-74415307 TCTGGCTCAGGTCTGCCCTGGGG - Intergenic
1160554326 18:79716260-79716282 CGGGGCTCAGGAAAGCCTTGTGG + Intronic
1160735092 19:658749-658771 CTGGGCCGAGGCACGCCCTGGGG - Intronic
1163491868 19:17621557-17621579 CAGGGCTCAGATGAGCCCTGTGG + Intronic
1165304491 19:34995193-34995215 CCGGGCTCTGGTGCCCACTGAGG + Intronic
1167207163 19:48110474-48110496 CCAGGCTCAGGCAAGCCGTGGGG - Exonic
1167240594 19:48340934-48340956 CAGGGCTCAGGTAGGATCTGAGG - Intronic
927194245 2:20536949-20536971 CAGGGCTCAGGCACTGCCTGCGG - Intergenic
927844024 2:26462169-26462191 CTGGGCCCAGGTACGAGCTGCGG - Exonic
931464295 2:62473326-62473348 CCAGGCTCAGCTGCTCCCTGTGG + Intergenic
933994633 2:87659170-87659192 CAGGGCTCAGCTATACCCTGGGG + Intergenic
935194211 2:100802389-100802411 CCAGGCTCACGAAAGCCCTGGGG - Intergenic
936299223 2:111291743-111291765 CAGGGCTCAGCTATACCCTGGGG - Intergenic
937140424 2:119595534-119595556 CCGGGCTCACCTCCTCCCTGTGG + Intronic
938248866 2:129798486-129798508 CCGGGCTCAGTTCCCTCCTGTGG - Intergenic
940128326 2:150352804-150352826 ATGGGCTCAGGTACGCTCTGCGG + Intergenic
940503884 2:154527959-154527981 CTGGGCTCAGGTCAGCCCTAGGG + Intergenic
946186516 2:217983674-217983696 CCGGGGTCAGGTGCACACTGAGG - Intronic
948597601 2:239090221-239090243 CCTGGCTCTGGTAGGCCCTGGGG - Intronic
1172064115 20:32207460-32207482 CCGGCCCCAGATAGGCCCTGGGG - Intronic
1175225503 20:57441749-57441771 CCGGGCTCAGGAGCACACTGAGG + Intergenic
1176388514 21:6151550-6151572 CCCGGATCAGGAAAGCCCTGTGG + Intergenic
1179734958 21:43386698-43386720 CCCGGATCAGGAAAGCCCTGTGG - Intergenic
1183099214 22:35573656-35573678 CCGGATTCAGGCACGCCGTGGGG + Intergenic
1184285562 22:43469133-43469155 CGGGGTTCAGGTACTTCCTGTGG + Intronic
952883259 3:37998355-37998377 CCGGGCTGTGGTGAGCCCTGGGG + Exonic
953026900 3:39150704-39150726 GCAGGCTCAGATACGCACTGCGG + Intronic
954627844 3:52032345-52032367 CAAGGCTAAGGTACACCCTGTGG - Intergenic
962266578 3:133948488-133948510 CCTGGCCCAGGCAAGCCCTGCGG + Intronic
966079049 3:175977600-175977622 CCGAGCGCAAGTACTCCCTGTGG - Intergenic
968123609 3:196143050-196143072 CTCGGCTCAGGCCCGCCCTGGGG - Intergenic
969432828 4:7165987-7166009 CTGGGCTCAGGTGCACACTGGGG + Intergenic
975763457 4:77641227-77641249 CAGGTCCCAGGTAGGCCCTGTGG + Intergenic
982712178 4:158768869-158768891 CCGGGCTCACGTAACCCCGGCGG - Intergenic
984565534 4:181325786-181325808 CCAGCCTCAGGTAGGCCCTTTGG + Intergenic
985577158 5:678751-678773 CAGGGCGCAGGGACGCCCTCTGG + Intronic
985682967 5:1266067-1266089 GCAGGCTCAGGTGCACCCTGGGG + Intronic
1003479337 6:6516842-6516864 CTGAGCTCAGAGACGCCCTGGGG + Intergenic
1006389972 6:33752429-33752451 GCAGGCTCAGGCATGCCCTGGGG - Intergenic
1018034098 6:159866919-159866941 CCGGGCTCAGGGACGCCTTGTGG + Intergenic
1019496332 7:1342161-1342183 CCGGCCTCAGGTCCTCCCGGGGG + Intergenic
1023000288 7:35801344-35801366 CCGAGCTAGGGAACGCCCTGAGG + Intronic
1024217071 7:47256685-47256707 CCAGGCTCAGGTGCCCGCTGGGG - Intergenic
1024359553 7:48454539-48454561 CCGGGCTCTCCTATGCCCTGCGG + Intronic
1029701489 7:102249157-102249179 GCGGGCTCAGGTCCGGCCCGGGG - Exonic
1036558751 8:9883927-9883949 CTGGGCTCAGGTGCCTCCTGCGG + Intergenic
1036694904 8:10968006-10968028 CCGGGCTCAGGGGCCACCTGTGG + Intronic
1040514777 8:48125949-48125971 TTGGGCTCAGGCACCCCCTGTGG + Intergenic
1042816381 8:72882126-72882148 TCGGGCACAGGTGTGCCCTGAGG - Intronic
1048998093 8:139806551-139806573 CCCGGTTCAGGTACACCCTTGGG - Intronic
1049201977 8:141344836-141344858 ATGGGCTCAGGTAGGCCCTAGGG + Intergenic
1049607653 8:143537139-143537161 CTGGGCTCAGGGACTCCATGAGG - Intronic
1049782362 8:144434817-144434839 CCAGGCTCTGGCAGGCCCTGCGG + Exonic
1185901666 X:3902426-3902448 CCGGGCTCTGCTCCGCTCTGAGG - Intergenic
1190266308 X:48829201-48829223 CCGGGCTCAGGCACGCCGCAGGG + Exonic
1199878888 X:151957057-151957079 CAGGGCTCATGCAGGCCCTGTGG + Intronic
1200141371 X:153904568-153904590 CCGGGACCAGGGAGGCCCTGGGG + Intronic