ID: 1122589541

View in Genome Browser
Species Human (GRCh38)
Location 14:102837380-102837402
Sequence CTTTGGAAGGTCAAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124595
Summary {0: 2, 1: 166, 2: 3351, 3: 31924, 4: 89152}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122589541_1122589548 -2 Left 1122589541 14:102837380-102837402 CCTTCCACCTTGACCTTCCAAAG 0: 2
1: 166
2: 3351
3: 31924
4: 89152
Right 1122589548 14:102837401-102837423 AGTCAAAGTGCTGGGATTACAGG 0: 5
1: 249
2: 15693
3: 321092
4: 265575
1122589541_1122589549 17 Left 1122589541 14:102837380-102837402 CCTTCCACCTTGACCTTCCAAAG 0: 2
1: 166
2: 3351
3: 31924
4: 89152
Right 1122589549 14:102837420-102837442 CAGGTGTGAGCCACCGTGCCTGG 0: 5442
1: 34090
2: 96783
3: 140914
4: 159590
1122589541_1122589546 -10 Left 1122589541 14:102837380-102837402 CCTTCCACCTTGACCTTCCAAAG 0: 2
1: 166
2: 3351
3: 31924
4: 89152
Right 1122589546 14:102837393-102837415 CCTTCCAAAGTCAAAGTGCTGGG 0: 2
1: 4
2: 5
3: 43
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122589541 Original CRISPR CTTTGGAAGGTCAAGGTGGA AGG (reversed) Intronic
Too many off-targets to display for this crispr