ID: 1122590985

View in Genome Browser
Species Human (GRCh38)
Location 14:102850979-102851001
Sequence CACGGCAATCATACACATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 61}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122590985_1122590989 8 Left 1122590985 14:102850979-102851001 CCAGCATGTGTATGATTGCCGTG 0: 1
1: 0
2: 0
3: 2
4: 61
Right 1122590989 14:102851010-102851032 AGGCGCATGTGTCCAGCATCTGG 0: 1
1: 0
2: 0
3: 7
4: 82
1122590985_1122590990 9 Left 1122590985 14:102850979-102851001 CCAGCATGTGTATGATTGCCGTG 0: 1
1: 0
2: 0
3: 2
4: 61
Right 1122590990 14:102851011-102851033 GGCGCATGTGTCCAGCATCTGGG 0: 1
1: 0
2: 0
3: 7
4: 79
1122590985_1122590991 15 Left 1122590985 14:102850979-102851001 CCAGCATGTGTATGATTGCCGTG 0: 1
1: 0
2: 0
3: 2
4: 61
Right 1122590991 14:102851017-102851039 TGTGTCCAGCATCTGGGCATTGG 0: 1
1: 0
2: 3
3: 17
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122590985 Original CRISPR CACGGCAATCATACACATGC TGG (reversed) Intronic
903143737 1:21356286-21356308 CACCCCAATCACACACAGGCTGG - Intergenic
904402392 1:30265399-30265421 CACGGCAACCACACACAGACAGG + Intergenic
904707553 1:32402714-32402736 CACGGCCATCACAAACATGGGGG + Intergenic
908101308 1:60794137-60794159 CAGGGCAATCATAAACAAGGTGG - Intergenic
911947601 1:104132321-104132343 CAATGCAATCATAGAAATGCAGG + Intergenic
912503437 1:110137647-110137669 CACGACTATCATACCCATGAAGG - Intergenic
1064167330 10:12997686-12997708 CATGACAATCATACACAGTCAGG + Intronic
1067199846 10:44157770-44157792 CACTCCAATTATACAAATGCTGG - Intergenic
1072754066 10:98006359-98006381 GACTGCAATCATGCACCTGCTGG + Intronic
1077198646 11:1294180-1294202 CACGGCTTTCATAGAAATGCAGG - Intronic
1077922805 11:6654652-6654674 CACAGCCATCATACACTTCCAGG - Intronic
1079137162 11:17782043-17782065 CAGGGTAATCATACAGTTGCAGG - Exonic
1082267932 11:50139616-50139638 CAAGGCAATCTCACATATGCAGG - Intergenic
1082288157 11:50338905-50338927 CAAGGCAATCTCACATATGCAGG + Intergenic
1094291712 12:28858034-28858056 CAGGGCAATCCCACAGATGCTGG - Intergenic
1098537300 12:71607542-71607564 AAGGGCAATGATACACCTGCAGG + Intergenic
1102766174 12:115435061-115435083 CAAGAAAATCATACACAGGCTGG - Intergenic
1106352981 13:28952481-28952503 CATGGGAATCATACACATATTGG + Intronic
1122317383 14:100834274-100834296 CATGGCAGTCATTCACATACAGG + Intergenic
1122590985 14:102850979-102851001 CACGGCAATCATACACATGCTGG - Intronic
1122827604 14:104377916-104377938 CAGGGCAATCGTACATATGCAGG + Intergenic
1127821011 15:62656225-62656247 CACCACAACCAAACACATGCGGG - Intronic
1130682946 15:86012272-86012294 CCTGTCAATCATACAAATGCTGG + Intergenic
1131910642 15:97196522-97196544 AACAGCAATTAAACACATGCTGG + Intergenic
1142147440 16:88498477-88498499 CACGTCCCTCATACACACGCTGG - Intronic
1152905976 17:82971167-82971189 CACGGCAATTATATCCAGGCCGG + Intronic
1155777193 18:29779574-29779596 CAAGGCAGTCATACATATCCTGG + Intergenic
1160009893 18:75098518-75098540 AAAGGCAATCATTCAAATGCTGG - Intergenic
1162386870 19:10365203-10365225 CCCCAAAATCATACACATGCTGG + Intronic
1163314158 19:16531216-16531238 CCCGCCCATCATACACAGGCAGG - Intronic
1167364059 19:49045337-49045359 CAGGGCAATCACACACACACAGG + Intergenic
937912709 2:127083405-127083427 CTGGGCAAACATACAAATGCAGG - Intronic
940031851 2:149272032-149272054 CACAGCAATCAAAGACATGAAGG - Intergenic
946962015 2:224995465-224995487 CACGCCAATAATACACAGGAGGG + Intronic
1170738564 20:19032427-19032449 TACAACAATCATACCCATGCAGG - Intergenic
1174908186 20:54574716-54574738 CCTGGCAATCATAGACATGTGGG + Intronic
1175259736 20:57666959-57666981 CACGGGAATGATACACACGATGG + Intronic
1175446747 20:59025695-59025717 CTCGGCAACCATTCAAATGCAGG + Exonic
1179152290 21:38819396-38819418 CAGTGCAATCATGCACCTGCTGG - Intronic
1185097648 22:48820522-48820544 CACGACACACATGCACATGCAGG - Intronic
951190112 3:19758374-19758396 CACGGCAATTTTACACATAATGG - Intergenic
952528657 3:34240821-34240843 AATGGCACACATACACATGCAGG + Intergenic
953706928 3:45238200-45238222 CACTGCAACCAAATACATGCAGG + Intergenic
956909652 3:73804329-73804351 CAAGGCAATCTCACACGTGCAGG - Intergenic
962167282 3:133062841-133062863 CACTCCACTCATACACATGAAGG - Intronic
966878673 3:184337626-184337648 CACAGAAATCATAGGCATGCTGG - Exonic
969637512 4:8377903-8377925 CACGGCACCCAGACACATCCGGG + Intronic
983913009 4:173261054-173261076 GACGACAATTATACAGATGCAGG - Intronic
996924735 5:128811170-128811192 CACGGCACTCACACACTTACAGG - Intronic
1010020990 6:71159603-71159625 CTCGGCAATCATATTCCTGCAGG + Intergenic
1014565279 6:122941348-122941370 CACGGCAATCATGCAGAAGAAGG - Intergenic
1022014144 7:26334466-26334488 CAGGGCCAACATGCACATGCAGG + Intronic
1024228021 7:47343122-47343144 CACTGGAATCTAACACATGCTGG + Intronic
1026432171 7:70358349-70358371 CAAGGCAAGCATACACATGGAGG + Intronic
1033285597 7:140038151-140038173 CACGGCAGCCATTCAAATGCCGG + Intronic
1033404608 7:141060654-141060676 CAGGGCAAGCATACAAATGAAGG - Intergenic
1046718460 8:117592587-117592609 CAAGGCCATCATAGACATCCAGG + Intergenic
1053296978 9:36922264-36922286 CACGGGACTCGTAGACATGCAGG - Intronic
1056940744 9:90953994-90954016 CACTGCATTCATGCACCTGCTGG - Intergenic
1058229261 9:102405996-102406018 AATGGCAATCATGCACCTGCTGG - Intergenic
1059641845 9:116224862-116224884 CAATGAAATCATAGACATGCAGG - Intronic
1191207824 X:57853132-57853154 CACTGCAAACATCCACATGGTGG - Intergenic
1192893697 X:75417714-75417736 CAGGGCAATTATCCACATGTGGG + Intronic
1202025098 Y:20513168-20513190 CAGGGCAGTAACACACATGCAGG - Intergenic