ID: 1122593871

View in Genome Browser
Species Human (GRCh38)
Location 14:102875043-102875065
Sequence CAGGCTAATGCTGCTTTTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 1, 2: 0, 3: 17, 4: 216}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122593871 Original CRISPR CAGGCTAATGCTGCTTTTTT TGG Intronic
902367087 1:15983053-15983075 CAGGCTGATTCTGCTTTCTCTGG + Intergenic
903595836 1:24493807-24493829 CAGGCTAATTTTTTTTTTTTTGG + Intergenic
903889925 1:26562639-26562661 GAAGCTAATGCTACTGTTTTGGG - Intronic
909330549 1:74404634-74404656 GAGACTAATGCTGCTGATTTGGG + Intronic
909920263 1:81373061-81373083 CATGCTAATGCTGCTAATTTGGG + Intronic
910191422 1:84599845-84599867 CTGGCTAATTTTTCTTTTTTGGG - Intergenic
911213752 1:95169254-95169276 CATGCTGATGCTGCTTATCTGGG + Intronic
915978638 1:160406888-160406910 CTGGCTAATTTTGCATTTTTTGG + Intronic
915996311 1:160567721-160567743 GAGGCTAATGCTGCCTTTGGTGG + Intronic
919066740 1:192701115-192701137 AAGGCTAATGCTGTTTTCTATGG + Intergenic
919273523 1:195382795-195382817 CTGGCTAATTTTTCTTTTTTTGG - Intergenic
919688603 1:200507897-200507919 CAGTCTACTGCAGCTCTTTTCGG + Intergenic
921637351 1:217512158-217512180 CTGGCTAATTTTTCTTTTTTTGG - Intronic
921759984 1:218902013-218902035 CAGGGTCATGCTGCTTTATTTGG + Intergenic
922003106 1:221501368-221501390 CCGGCTGGGGCTGCTTTTTTGGG - Intergenic
922103172 1:222490794-222490816 CTGGCTAACGTTTCTTTTTTTGG - Intergenic
922439262 1:225638973-225638995 GAGGCTAATGCTGCTTTGGGAGG - Intronic
923049194 1:230378886-230378908 CAGGCAATGGCTGCTTTCTTTGG - Intronic
923294393 1:232579630-232579652 CATGAAATTGCTGCTTTTTTAGG - Intergenic
924345330 1:243068301-243068323 CTGGCTAATGTTTCTTTTTTTGG - Intergenic
1065009112 10:21405779-21405801 CACCCAAATGTTGCTTTTTTTGG + Intergenic
1066731004 10:38436508-38436530 CTGGCTAATGTTTCTTTTTTTGG + Intergenic
1072479320 10:95795297-95795319 CAGGATGATGCTGCTGTTCTTGG + Intronic
1072708493 10:97699640-97699662 AATGCTGCTGCTGCTTTTTTTGG + Intergenic
1073813306 10:107175595-107175617 CTGGCTAATGCTTGTATTTTTGG + Intergenic
1073902537 10:108240202-108240224 CAGGCTAATGCTTCCCCTTTGGG + Intergenic
1075697088 10:124444505-124444527 CAGGCACATGCTGCTATGTTTGG - Intergenic
1076250506 10:128980560-128980582 CAGGCTCAGGCTGGTCTTTTGGG + Intergenic
1077914431 11:6602067-6602089 CTGGCAAATGATGCCTTTTTGGG + Exonic
1079070169 11:17338070-17338092 CTTGCTGATGCTGCTTTTTCTGG - Intronic
1079366190 11:19812222-19812244 CATGCTAATGCTGCTGGTCTGGG + Intronic
1079670723 11:23167089-23167111 CAAGATAATGCTGCTTTTACAGG + Intergenic
1080281105 11:30557829-30557851 CAGGCTAATGTTTCTTTGATTGG - Intronic
1081919058 11:46755765-46755787 CAGGCTAATTTTTCTATTTTTGG - Intronic
1082064861 11:47891800-47891822 CTGGCTAATGTTGTATTTTTAGG + Intergenic
1083179531 11:60975636-60975658 CAGGCTAATTTTGTATTTTTTGG - Intronic
1086883885 11:92180989-92181011 GATGTTAATGCTGCTTGTTTGGG + Intergenic
1088472993 11:110206925-110206947 GAGTCTGATGCTGCTGTTTTGGG - Intronic
1090450141 11:126798753-126798775 CAGGCTAATGCTGCTCCGTATGG - Intronic
1091500657 12:1014335-1014357 CTGGCTAATGTTGGTATTTTTGG + Intronic
1092047945 12:5445892-5445914 CAGGCAAATGCTGGATTTTTAGG - Intronic
1092549218 12:9479453-9479475 CTGGCTAATTTTGCATTTTTTGG - Intergenic
1093267500 12:17021000-17021022 TAGGCTAATGTTGCTTTGCTTGG + Intergenic
1094409411 12:30152995-30153017 TAGGCTAATGCTGTTTTCATAGG - Intergenic
1095753307 12:45734205-45734227 CAGGCTAATTTTTCTATTTTTGG - Intronic
1095761399 12:45841508-45841530 TAGTTTAATGCTGCTTTTTTTGG + Intronic
1096346968 12:50857346-50857368 AATGCAAATGCAGCTTTTTTAGG + Intronic
1096569846 12:52515869-52515891 TAGACTAATGCTGTCTTTTTGGG - Intronic
1097121643 12:56737509-56737531 CCGGCTAATTCTGTATTTTTAGG + Intronic
1098647404 12:72920447-72920469 CAGGCTAATTTTTCTATTTTTGG + Intergenic
1099349980 12:81554329-81554351 CAGGATAATGGTGCTTCTCTTGG + Intronic
1100402666 12:94245833-94245855 CAGTCTGACGCTGCTTTTTGTGG - Intronic
1100903035 12:99265196-99265218 GATGCTAATGCTGCTGTTCTGGG - Intronic
1101932368 12:109024913-109024935 CAGCCTAAAGCAGCATTTTTTGG + Intronic
1102574585 12:113848310-113848332 CAGGGTAATTCTGCTATTTTTGG - Intronic
1105309549 13:19194174-19194196 CTGGCTAACGTTGGTTTTTTTGG + Intergenic
1107461220 13:40605597-40605619 CAGGCTGAGGCTGTATTTTTGGG - Intronic
1112342133 13:98561419-98561441 CCGGCTAATGCTTGTATTTTTGG - Intronic
1116637064 14:47410205-47410227 CAGGTTAATTATGCTTTTCTTGG - Intronic
1116730623 14:48617139-48617161 CAGTCTCCAGCTGCTTTTTTGGG + Intergenic
1117102590 14:52365564-52365586 CAGGCTAGTGCTGTTGTCTTAGG + Intergenic
1117208763 14:53473253-53473275 CAGGGGAAAGCTGTTTTTTTAGG + Intergenic
1117618037 14:57554301-57554323 CAGACTGATGCCTCTTTTTTTGG + Intergenic
1118251700 14:64168093-64168115 TAGGCAGATCCTGCTTTTTTTGG + Intronic
1121337490 14:93086233-93086255 CACACTTATGCTGCTATTTTAGG - Intronic
1122593871 14:102875043-102875065 CAGGCTAATGCTGCTTTTTTTGG + Intronic
1124399100 15:29333104-29333126 CAGGCTCTAGCTGCTTTCTTAGG - Intronic
1126534288 15:49743676-49743698 CAACCTAATGGTGCTTTTTAAGG + Intergenic
1127751835 15:62053392-62053414 CAGGCTCATGCTGATATTTGTGG - Intronic
1130001390 15:80050215-80050237 CTGGCAAATGCTGATTTATTTGG - Intergenic
1130938782 15:88490973-88490995 CAGTCTAATGCTGTGCTTTTCGG - Intergenic
1131741646 15:95399343-95399365 CACGCTAATGCTGATTTTACAGG - Intergenic
1133289431 16:4709242-4709264 CTGGCTAATTTTGCATTTTTGGG - Intronic
1134286511 16:12866762-12866784 CGGACTAATGCAGCTTTTCTTGG + Intergenic
1135574634 16:23575832-23575854 CAGGCAAATGCTGTTTCTCTAGG + Intergenic
1138901245 16:61273685-61273707 CAGGAAAATGCTGCTTTTATTGG + Intergenic
1138903006 16:61297031-61297053 CATCCAAATGTTGCTTTTTTTGG - Intergenic
1140647422 16:77048213-77048235 GAGGCTAATGTTGCTCTTTATGG + Intergenic
1141922307 16:87144187-87144209 CTGGCTCATTCTGCCTTTTTGGG + Intronic
1142653291 17:1371631-1371653 CAGGCTGATGCAGCTTCTTAGGG - Intronic
1144948904 17:18983614-18983636 CAGGCTCCTGCTGCTATGTTGGG - Intronic
1145219284 17:21075094-21075116 CTGGCTAATTCTGTATTTTTAGG + Intergenic
1146385501 17:32368841-32368863 CCGGCTAATTCTGTATTTTTAGG - Intronic
1147684127 17:42276687-42276709 CAAGCACATGCTGCTTTGTTTGG + Intronic
1150311674 17:64133831-64133853 CAGGCACAAGCTCCTTTTTTGGG - Intergenic
1151051390 17:70983070-70983092 TATGCTAATGGTGCTTTTGTTGG - Intergenic
1151236298 17:72722136-72722158 CATGCTAATGATTCTCTTTTGGG + Intronic
1153812471 18:8764224-8764246 CAGGGTAATATTGCTTTTTATGG + Intronic
1153993425 18:10419776-10419798 CATGCTAATGCCACTGTTTTTGG - Intergenic
1154943959 18:21142308-21142330 CTGGCTTATGCTGCCTTGTTAGG - Intergenic
1157763161 18:50279998-50280020 CAGGCTACTGCTGCTTCCTGTGG - Exonic
1161359659 19:3840690-3840712 AAGGCTAATTTTGTTTTTTTGGG + Intronic
1161556273 19:4944485-4944507 CGGGCTCATCCTGCTTTTCTGGG + Intronic
1162527673 19:11215953-11215975 CAGGCTGACTCTGCTCTTTTCGG + Intronic
1164094875 19:21998595-21998617 CTGGCTAATTCTGTTATTTTTGG + Intronic
1164748688 19:30635317-30635339 CAGTCCAATTCTGCTCTTTTTGG + Intronic
1166464183 19:43017961-43017983 CAGGCAAATGCTGGTGGTTTTGG + Intronic
1168093586 19:54101692-54101714 CCGGCTAATTTTTCTTTTTTAGG - Intronic
925869059 2:8253527-8253549 CAGGCTTATGATGCTTCGTTAGG - Intergenic
928502515 2:31911939-31911961 CAGCCTAATGCTGTTAATTTTGG + Intronic
933371940 2:81425467-81425489 CAAGCTGATGTGGCTTTTTTGGG + Intergenic
933415057 2:81977135-81977157 GAGGCTAATGCTGATATATTGGG - Intergenic
933711200 2:85327399-85327421 CTTGCTAGTGCTGCCTTTTTGGG + Exonic
935049512 2:99512651-99512673 TTGGCTAATGTTGCCTTTTTTGG + Intergenic
937523959 2:122744543-122744565 CAGCTTCATGCTGCTCTTTTGGG - Intergenic
938889908 2:135693841-135693863 CCGGCTAATTCTGTATTTTTAGG - Intronic
940021142 2:149156907-149156929 CAGGCTAATGGGACTATTTTAGG + Intronic
940343319 2:152603550-152603572 CAGGCTAGTGATGTGTTTTTTGG + Intronic
940661737 2:156553841-156553863 AAAGCTAATGCTGAATTTTTAGG - Intronic
941990201 2:171548211-171548233 GATGCTAATGCTGCTGTTCTAGG - Intronic
942546364 2:177068514-177068536 TAGGCCATTGCTGCTCTTTTGGG + Intergenic
942974598 2:182000410-182000432 CATGCTAATGCCACTATTTTTGG - Intronic
944409949 2:199430252-199430274 CAGGGTACTGCTGCTATTCTGGG - Intronic
946686631 2:222277770-222277792 CAGGCTAATTTTTCTATTTTTGG - Intronic
947532773 2:230923356-230923378 TGTGCCAATGCTGCTTTTTTAGG - Intronic
948966193 2:241382443-241382465 CCGGCTAATTTTGCATTTTTTGG + Intronic
1169344520 20:4819962-4819984 CAGGTTGATGCTGCTGTTTGCGG - Intronic
1170158687 20:13291259-13291281 CTGGCTATTGCAGCTTTTCTGGG + Intronic
1171514622 20:25719515-25719537 CACCCTAATGCTGCACTTTTCGG - Intergenic
1171817800 20:29803819-29803841 CAGCCTAAGGCTGCTTTTGGTGG + Intergenic
1171819013 20:29816265-29816287 ATGGCTATTTCTGCTTTTTTTGG + Intergenic
1172712501 20:36936820-36936842 CTGGCTAATTTTTCTTTTTTTGG + Intronic
1178336696 21:31749809-31749831 CTGGCTAATTCTGGTATTTTTGG - Intergenic
1180322990 22:11340964-11340986 ATGGCTATTTCTGCTTTTTTTGG + Intergenic
1182752563 22:32653551-32653573 CAGGCTCATGGTGTATTTTTGGG + Intronic
949528565 3:4930706-4930728 CAGGCTAATGCTTCTGGTTGGGG - Intergenic
952079310 3:29738782-29738804 AAGGCTAATGTTGCATTTCTGGG + Intronic
952138787 3:30455195-30455217 CAGGCTAATTTTTCTATTTTTGG + Intergenic
953306051 3:41830629-41830651 TAGTCTAATTCTTCTTTTTTTGG - Intronic
953642262 3:44720042-44720064 CAAGCCAATGCTGATTTTTGCGG + Intronic
954065367 3:48101658-48101680 CTGGCTAATTTTTCTTTTTTTGG - Intergenic
954740226 3:52743702-52743724 GAGGATAATGCTGCATATTTTGG + Intronic
955533248 3:59896863-59896885 AAGTGTAATGTTGCTTTTTTTGG + Intronic
955783437 3:62510534-62510556 CAGGCTTTTGCATCTTTTTTTGG + Intronic
956168699 3:66415871-66415893 CAAACAAATGCTGCTTTTTCTGG + Intronic
957593341 3:82227675-82227697 CAGACTAATGTGGCTGTTTTTGG + Intergenic
958992392 3:100861990-100862012 CATGCTGATGCTTCTTATTTTGG + Intronic
961418513 3:126780731-126780753 CAGGGTAATGCTGCTGTGTGTGG + Intronic
962578296 3:136774485-136774507 CAAGCTAATTCTTCTATTTTTGG + Intergenic
962698074 3:137970618-137970640 CAGCCTGATACTGCTTTTGTAGG - Intergenic
962769787 3:138601585-138601607 CAGGCTGATCCTGCTTTTGAAGG - Intergenic
963204219 3:142615864-142615886 AATGCTAATGCTGCTTGTCTGGG - Intronic
963774971 3:149429427-149429449 CAGGTTAATGCTGCTGCTTTAGG - Intergenic
964928797 3:161990021-161990043 CAATCTAATGTTGCTTTCTTTGG + Intergenic
964955036 3:162344321-162344343 CAAATTAATGCTGATTTTTTGGG + Intergenic
964956743 3:162368317-162368339 CACTGGAATGCTGCTTTTTTAGG + Intergenic
965683672 3:171278515-171278537 CAGACTAGTGTGGCTTTTTTTGG - Intronic
967583127 3:191183578-191183600 ATGGCTGATGCTGCTTTTTGTGG - Intergenic
970741293 4:19241020-19241042 AGGGAAAATGCTGCTTTTTTAGG + Intergenic
973912638 4:55597528-55597550 CAGGCTAATTTTGTATTTTTAGG + Intronic
974003871 4:56536416-56536438 CAGGCCAATAATGCTGTTTTTGG - Intronic
976999939 4:91484715-91484737 GATGCTAATGCTACTGTTTTGGG - Intronic
979003389 4:115257000-115257022 CAGGATAATACTGGTTCTTTAGG - Intergenic
979257385 4:118619377-118619399 CTGGCTAATGTTTCTTTTTTTGG + Intergenic
979330966 4:119421171-119421193 CTGGCTAATGTTTCTTTTTTTGG - Intergenic
981827048 4:148955351-148955373 AAGGCTACTGCTTCCTTTTTGGG - Intergenic
983093184 4:163530199-163530221 CAGGGTAACGCTGTTATTTTTGG - Intronic
987686701 5:21213862-21213884 CAGGCTAATTTTTCTATTTTTGG - Intergenic
990019657 5:51109443-51109465 CAGGCTCCTTCTACTTTTTTGGG + Intergenic
990468992 5:56096058-56096080 CAGTCTAACCCTGGTTTTTTTGG - Intergenic
991164461 5:63547505-63547527 TATGCTAATGCTGCTGGTTTGGG + Intergenic
993017525 5:82551796-82551818 CAGGATAATGCTTATTTTTGTGG + Intergenic
993253320 5:85556164-85556186 CAGGCTTATTATGATTTTTTTGG - Intergenic
995646456 5:114318200-114318222 CAGGATAATGCTGTGTTTTAAGG + Intergenic
995891315 5:116955337-116955359 GAGGCTAATGCTGCTTGTCAAGG + Intergenic
999960706 5:156753046-156753068 GATGCTGATGCTGCTTGTTTCGG - Intronic
1003557531 6:7154232-7154254 GATGCTAATGCTGCTTGTCTGGG - Intronic
1004687347 6:17959859-17959881 CAGGCTAATTTTGTATTTTTAGG - Intronic
1007076413 6:39069763-39069785 CAAGCTACTGCTACATTTTTAGG + Intronic
1009167350 6:60357016-60357038 CAGTCTAATGCTGTTTGTTGTGG + Intergenic
1009360999 6:62814291-62814313 CGGGCTGATGCTCCTATTTTAGG - Intergenic
1009838190 6:69031794-69031816 CAGGCTAATTTTGGTATTTTTGG + Intronic
1010179266 6:73065982-73066004 CAGGCTAATTTTGTATTTTTGGG - Intronic
1010954317 6:82072853-82072875 CAGAATATTTCTGCTTTTTTTGG - Intergenic
1011109892 6:83826129-83826151 CTGGCTAGTGGTGCTGTTTTTGG - Intergenic
1011254612 6:85407681-85407703 TTGGCTAATGCTGCTCTTGTGGG + Intergenic
1012805934 6:103892914-103892936 CAGGTTCATGCTGGTTATTTGGG - Intergenic
1015299230 6:131633755-131633777 CAGGCTAATGCTGCTGTTTTAGG + Intronic
1015929404 6:138342270-138342292 GAGGCCAATACTGCTGTTTTGGG + Exonic
1017024059 6:150166375-150166397 CAGCCAAATGCTGCTCTTCTTGG + Intronic
1018978251 6:168581973-168581995 CAAGCTAATGCTGATTGTTTGGG - Intronic
1019467444 7:1197159-1197181 CTGGCTAATTCTTTTTTTTTGGG + Intergenic
1019671814 7:2283955-2283977 CTGGCTAATTTTGCATTTTTAGG + Intronic
1019855704 7:3604762-3604784 CAGGCTAATTTTGTATTTTTAGG + Intronic
1020486092 7:8722540-8722562 TAGGTTAATGCCTCTTTTTTAGG + Intronic
1020849273 7:13329970-13329992 TAGGCTGATCCTGCTGTTTTTGG + Intergenic
1022789879 7:33676590-33676612 CAGGCTGTTGCTGTGTTTTTCGG - Intergenic
1022809059 7:33851142-33851164 AAGGCTACTGCTGCATCTTTTGG + Intergenic
1024072306 7:45796458-45796480 CTGGCTAATGTTTCTTTTTTTGG + Intergenic
1024958019 7:54946405-54946427 CAGTCACATGCTGCTCTTTTGGG + Intergenic
1027268629 7:76507829-76507851 TATGCTAATGCTGCTTTCTGAGG - Intergenic
1029060950 7:97797487-97797509 GAGGCTAAAGGTGCTTTCTTTGG + Intergenic
1030236594 7:107270060-107270082 CAGGCTGCTACTGCCTTTTTAGG + Intronic
1030344624 7:108418487-108418509 CAGGCCAATGCTGCTTTCACAGG - Intronic
1031235061 7:119165025-119165047 CAGGGTAATGCTGGTTTTGTAGG + Intergenic
1031509660 7:122634168-122634190 CAGGATAATGCTGGCTTTGTAGG + Intronic
1032049694 7:128640147-128640169 CTGGCTAATGTTTCTTTTTTTGG + Intergenic
1032214720 7:129949068-129949090 AAGGCTAGAGCTGCTTGTTTTGG - Intronic
1032682677 7:134201718-134201740 CTGACTCATGCTGCTTGTTTTGG - Intronic
1033011869 7:137631819-137631841 CAGGCTAAAGCTGCTATATTAGG + Intronic
1038422520 8:27442590-27442612 CAGGCTCCTGCTGCATGTTTGGG + Intronic
1042467417 8:69143732-69143754 CAGTCTAATGCTACTGTATTTGG - Intergenic
1045072106 8:98518279-98518301 TAAGCTAATTCTGCTTATTTAGG - Intronic
1045323224 8:101097633-101097655 CAGTCAAATGCCGCTTTTGTTGG + Intergenic
1046182968 8:110676557-110676579 CATGCTAATGATTCTTTTCTGGG + Intergenic
1046334133 8:112760781-112760803 CAGGCCAGTGCTGCTCTTTTAGG + Intronic
1050027338 9:1349605-1349627 CCTGCAAATGCTGCTTTATTTGG + Intergenic
1050109158 9:2196898-2196920 CATGCTGATGCTGCTAGTTTGGG - Intergenic
1050315646 9:4398296-4398318 CATGCTAATGCTGCTAATTCAGG - Intergenic
1051796610 9:20878917-20878939 CAGGCTTCTGCTGCTGCTTTTGG - Intronic
1052937488 9:34105089-34105111 CAGGCTAATTTTTCTATTTTTGG - Intronic
1053182650 9:35986890-35986912 CAGGCTAATTTTGTATTTTTAGG - Intergenic
1053917469 9:42954206-42954228 CAGGTTTCTGCTGCTCTTTTGGG - Intergenic
1056143460 9:83707266-83707288 CGGGCTGATGCCGCTTTTCTCGG - Intronic
1056596864 9:88014890-88014912 CTGGCTAGTGCTTCTTTCTTTGG - Intergenic
1056934981 9:90909727-90909749 AAGGCTATTGCTGCTTTTAATGG - Intergenic
1057718467 9:97514221-97514243 CTGGCTAATGTTTTTTTTTTGGG + Intronic
1057998793 9:99844614-99844636 CAGGATAATGCTGCTCTCTCTGG + Intronic
1059539346 9:115115236-115115258 CAGGCTACTGCTGTATTTATGGG + Intronic
1060924820 9:127448986-127449008 CAGGCTAATTTTGTATTTTTTGG + Intronic
1061608550 9:131730382-131730404 CAGCCTAAGGCTGGTTCTTTGGG - Intronic
1203370675 Un_KI270442v1:301535-301557 ATGGCTATTTCTGCTTTTTTTGG + Intergenic
1187010866 X:15277937-15277959 CATGCTAATGCCACTATTTTGGG + Intergenic
1187130269 X:16495754-16495776 GATGCTACTGCTGATTTTTTGGG - Intergenic
1189097355 X:38154654-38154676 CAGGCCAGTGCTGCTTCTGTCGG - Intronic
1189180965 X:39004159-39004181 CAGGCCTATGTTGCTTTTCTCGG - Intergenic
1191033181 X:55997255-55997277 CTGGCTAATGATGCTTCTCTAGG - Intergenic
1193356904 X:80530245-80530267 CAGGCTAATTTTCCTATTTTTGG - Intergenic
1193421101 X:81283190-81283212 CAGGCTAATCCTGGACTTTTTGG - Intronic
1196636462 X:118008361-118008383 CAAGCTAGTTCTGCTTATTTTGG - Intronic
1196860597 X:120023930-120023952 CAGGCTAATTTTTTTTTTTTTGG + Intergenic
1196870156 X:120105705-120105727 CAGGATAATGTTCCTTTTTATGG - Intergenic
1198397459 X:136234775-136234797 CTGGCTAATGACGCTTTTGTTGG + Intronic
1199965046 X:152812685-152812707 TAGGTTAATGGTGCTTTATTGGG + Intergenic
1201236458 Y:11916579-11916601 GAGGCTAAGTCTTCTTTTTTTGG - Intergenic