ID: 1122594176

View in Genome Browser
Species Human (GRCh38)
Location 14:102877824-102877846
Sequence GTTGAGGGAGGGCCTGCGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 312
Summary {0: 1, 1: 1, 2: 2, 3: 17, 4: 291}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122594176_1122594182 0 Left 1122594176 14:102877824-102877846 CCTTCCGCAGGCCCTCCCTCAAC 0: 1
1: 1
2: 2
3: 17
4: 291
Right 1122594182 14:102877847-102877869 TCATAGATAATCCGTTCCACAGG 0: 12
1: 16
2: 3
3: 3
4: 35

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122594176 Original CRISPR GTTGAGGGAGGGCCTGCGGA AGG (reversed) Intronic
900996960 1:6127983-6128005 GTGGGGGGCGGGGCTGCGGATGG + Intronic
900996967 1:6128002-6128024 ATGGAGGGCGGGGCTGCGGATGG + Intronic
901076846 1:6560517-6560539 CTTGGCGGAGGGCCTGCAGATGG + Intronic
901296179 1:8162425-8162447 GTGGAGGGAGGGACAGGGGAAGG - Intergenic
901765369 1:11496654-11496676 GCTGTGGAGGGGCCTGCGGAGGG + Intronic
902283031 1:15388303-15388325 GGTGGGGCAGGGCCTGGGGAGGG - Intronic
902283048 1:15388336-15388358 GGTGGGGCAGGGCCTGGGGAGGG - Intronic
902631152 1:17705498-17705520 ACTGAGGGAGGCCCTGGGGAGGG + Intergenic
902633533 1:17719973-17719995 TTTGAGGGAGGGCGGGCAGAGGG + Intergenic
902730248 1:18364409-18364431 GTGGAGGGAGGGACTGCAGGGGG - Intronic
903224644 1:21887741-21887763 GTACAGGGTGGGCCTGGGGAGGG - Intronic
903249385 1:22041533-22041555 ATTGGGAGAGGGCCTGAGGAAGG - Intergenic
903786718 1:25866132-25866154 GTTGGGGGAGGGCCTGGAGAGGG - Intronic
904326073 1:29727786-29727808 GTGGAGGGTGGGCTTGGGGAGGG + Intergenic
904373567 1:30066059-30066081 GTGGAGGGAGGGCTGGGGGAGGG - Intergenic
904373587 1:30066115-30066137 GTGGAGGGAGGGCTTGGGGAGGG - Intergenic
904373609 1:30066171-30066193 GTGGAGGGAGGGCTGGAGGAGGG - Intergenic
904373661 1:30066309-30066331 GTGGAGGGAGGGCTTGGGGAGGG - Intergenic
904420111 1:30385738-30385760 GTGGAGTGAGGGGCTGTGGATGG - Intergenic
904591419 1:31617632-31617654 GGGGAGGGAGGGCCGGCGGGAGG - Intergenic
904661890 1:32091635-32091657 GGTGAGGGAAGGCCTGCCCATGG - Intronic
905215107 1:36401237-36401259 GTGGAGGGTGGGCCCCCGGAAGG + Intergenic
905224772 1:36472037-36472059 GTGGAGGGATGGCCTTCAGAGGG + Intronic
905789461 1:40782678-40782700 CCTGGGGCAGGGCCTGCGGAGGG + Intergenic
905891160 1:41519207-41519229 GTTCAGGGAAGGCCTGGGCAAGG + Intronic
908880587 1:68727292-68727314 TTTGTGGGAGGGCCTGGAGATGG - Intergenic
915010159 1:152678021-152678043 GGTGAAGGCTGGCCTGCGGAGGG + Intergenic
915518884 1:156429964-156429986 GTTGAGGGGAGGCCTGGGAAGGG - Intronic
915524255 1:156466538-156466560 GGGGTGGGAGGGCCTACGGATGG - Exonic
915570845 1:156744402-156744424 GCTGAGGGAGGGTCTGGGGAGGG - Intronic
915674257 1:157515809-157515831 GGTGGGGGAGGGCATGCAGAAGG + Intronic
918238299 1:182600565-182600587 GCTGAGGGAGGGCCAACGGCAGG + Intronic
921220427 1:212969796-212969818 GTTGAGCCAGGACCTGCAGAAGG - Intronic
922163783 1:223097853-223097875 TTTGAGGGAGGTCCTGGGGTTGG - Intergenic
922196259 1:223363240-223363262 GTGGTGGGAGGGCCTGGGGATGG - Intronic
923306872 1:232696661-232696683 GATGGGGGTGGGCCTGGGGAAGG + Intergenic
924037128 1:239949192-239949214 GTTGGGGGAGGGACTGAGAATGG - Intergenic
1062923361 10:1296591-1296613 GTTGGGGGAGGGCAGGGGGAAGG + Intronic
1062939001 10:1407809-1407831 GGGGAAGGAGGGCCTGGGGATGG - Intronic
1063379574 10:5575924-5575946 GCTGAGGGTGGGCCTCAGGAGGG + Intergenic
1065942212 10:30575230-30575252 GCTGGAGGAGGGCCTGGGGAGGG - Intergenic
1067726083 10:48772148-48772170 GTTGAGGGAAGGACTCGGGAGGG + Intronic
1069962454 10:72087148-72087170 GGTGAGGCAGGGCGGGCGGAGGG - Intronic
1069980761 10:72250869-72250891 GTTGAGGGAGTTCATGCAGAGGG - Intergenic
1071598944 10:86946962-86946984 GGTGAGGAAGGGGCTGCAGAAGG + Intronic
1072267403 10:93743913-93743935 AGTGAGGGAGGGCATGAGGAAGG - Intergenic
1075227332 10:120641312-120641334 GATGAGGGAGGGAGTGCGCAAGG + Intergenic
1075685877 10:124364787-124364809 GGGGAGGGAGGGCCTGAGAAAGG + Intergenic
1076564035 10:131386249-131386271 GTTGAGGGAGGACCAGAGGGAGG + Intergenic
1077017457 11:403310-403332 GTTGAGGGGGGGACAGAGGAGGG + Intronic
1077501480 11:2911496-2911518 GGTGAGGAAGGGCGTGAGGAGGG + Intronic
1077575621 11:3380831-3380853 GTTGTGGGAGGGACCGGGGAAGG + Intergenic
1079248895 11:18773028-18773050 GTAGAAGGAGGGCATGTGGACGG + Intronic
1080959735 11:37145023-37145045 GTTGTGGGAGGGACTGTGGTGGG - Intergenic
1081615270 11:44587154-44587176 GTTTAGGGAGGGCCTTTGGGAGG + Intronic
1083317995 11:61828134-61828156 GCTGAGGGAGGGGCGGAGGAAGG + Exonic
1084371977 11:68750849-68750871 GGTGAGGGAGGGCCAGGTGAGGG + Intronic
1085918611 11:80923819-80923841 TCTGAGGGAGGGCCTAAGGAAGG + Intergenic
1087094747 11:94307764-94307786 TTTAGGGGAGGGCCTGAGGAAGG - Intergenic
1087094772 11:94307843-94307865 TTTAGGGGAGGGCCTGAGGAAGG + Intergenic
1088594955 11:111434397-111434419 GTTGTGGGAGGGCTCGGGGAGGG + Intronic
1088794017 11:113251894-113251916 GATGAGGGAGGGGCTGTGGTGGG - Intronic
1089183549 11:116599213-116599235 ACTGAGGGAGGGGCTGCTGAAGG - Intergenic
1089385184 11:118062637-118062659 GTGGAGGGAGGGCCAGGAGAGGG - Intergenic
1090068869 11:123526588-123526610 TTTGAGGGAGGGTGTGCGGGGGG + Intronic
1090619681 11:128549601-128549623 TTCGAGGGCGGGCCGGCGGAAGG + Intronic
1091148764 11:133305739-133305761 TCTGAGGGAACGCCTGCGGAAGG - Intronic
1091230680 11:133986143-133986165 GCTGAGGGTGTGCGTGCGGAAGG - Intergenic
1091640043 12:2229626-2229648 GATGAGGGAAGGCCTCCGCAGGG + Intronic
1092564354 12:9648593-9648615 GTTGGGGGAGGGCCCGTGGGTGG - Intergenic
1094272940 12:28637403-28637425 GTTGTTGGAGAGCCTGAGGATGG - Intergenic
1096871916 12:54598174-54598196 GGTAAGGGAGGACTTGCGGAGGG + Intergenic
1100391342 12:94148490-94148512 GTGGAGGGAGGGCGGGCGGGCGG + Intergenic
1102119603 12:110429852-110429874 GGTGATGGTGGGCCTGCGGAAGG + Intergenic
1102490217 12:113286059-113286081 GCAGAGGGAGGGTCTGAGGATGG + Intronic
1104943416 12:132405223-132405245 GCTGAGGGAGGGCCCTCGGCGGG - Intergenic
1105722901 13:23134622-23134644 GGTGATGGTGGGCCTGGGGAAGG - Intergenic
1110416582 13:75260089-75260111 GTGGAGGGAGGGCATGTGAAAGG - Intergenic
1113420265 13:110165571-110165593 GGTGAGGGAGGGTGTGTGGAAGG - Intronic
1113483943 13:110641167-110641189 CCTGAGGGAGGGGCTGGGGATGG - Intergenic
1113909810 13:113836553-113836575 GGTGAGGGAGGGGGTGGGGAGGG + Intronic
1113909822 13:113836575-113836597 GGTGAGGGAGGGGGTGGGGAGGG + Intronic
1113909834 13:113836597-113836619 GGTGAGGGAGGGGGTGGGGAGGG + Intronic
1119503112 14:75147799-75147821 GTAGAGGGAGGGCGGGCGGGTGG - Intronic
1121109691 14:91303684-91303706 GGAGAGGTAGGGCCTGGGGAAGG - Exonic
1122594157 14:102877717-102877739 GTTGAGGGAGGGCCTGTGGAAGG - Intronic
1122594176 14:102877824-102877846 GTTGAGGGAGGGCCTGCGGAAGG - Intronic
1123002160 14:105301338-105301360 GTGGAGAGACGGCCTGCGAAGGG + Exonic
1126450674 15:48805044-48805066 GGTGAGGGAGGGTCTGTGGGAGG - Intronic
1127350133 15:58142962-58142984 TCTGAGCGAGGGCCTGAGGATGG - Intronic
1128092912 15:64931175-64931197 GGTGAGGGAGGGCTTGCTGGAGG + Intronic
1129235272 15:74220007-74220029 GCTGGGAGAGGGCCTGGGGATGG + Intergenic
1129523632 15:76200816-76200838 GTTGAGGGAGGGCCCCGGGCTGG - Intronic
1132146739 15:99433675-99433697 ATTGGGGCAGGGCCTGGGGAAGG + Intergenic
1132513575 16:355350-355372 GTAGAGGAAGGCCCTGAGGAGGG + Intergenic
1132650803 16:1020712-1020734 GTGGAGGGAGGGCAGGCGGTGGG + Intergenic
1132668885 16:1094760-1094782 GTGGAGGGGGGACCTGTGGAGGG - Exonic
1132748395 16:1446398-1446420 GTGGAGGCTGGGCCTGCGCAAGG + Exonic
1132945761 16:2530755-2530777 CCTGAGGGAGGGCCTGGGGCAGG + Exonic
1132989808 16:2786878-2786900 GATGAGGGAGGGGGTGAGGATGG - Intronic
1133131866 16:3681072-3681094 GTTGAGCGAGGATCTGCAGATGG - Intronic
1133768786 16:8855714-8855736 GTTGAGGGGTGGCCTGGGCAGGG + Intronic
1134045964 16:11101315-11101337 GTTGGGGGTGAGGCTGCGGAGGG - Intronic
1134618599 16:15670698-15670720 GTTGAGGGAGGCTGTGTGGAGGG + Intronic
1135058946 16:19254603-19254625 GATGAGGTAAGGCCTGCAGAAGG - Intronic
1135565879 16:23510543-23510565 GTGGAGGGGGGGCCTGGGGTGGG - Intronic
1136069548 16:27779512-27779534 GTGCAGGGAGGGCCTGCTCAAGG - Exonic
1137706603 16:50539812-50539834 GTGGGGGGGGGGCCTGGGGAAGG + Intergenic
1138619347 16:58198532-58198554 TTTGAGTGAGGCCCTGGGGAGGG - Intergenic
1139489136 16:67277357-67277379 GTTGGGGAAGGGCCAGGGGAGGG + Intergenic
1139582323 16:67880842-67880864 CTTGATGGAGGCCCTGGGGATGG + Exonic
1140908649 16:79431152-79431174 GTTGAGGGATGGGGTGAGGATGG - Intergenic
1142477034 17:194592-194614 GAGGAGGGAGGGCGAGCGGAGGG + Intergenic
1142986359 17:3697331-3697353 GATGAGGGAGGGCCTCCGGGGGG + Intergenic
1143015277 17:3888308-3888330 GTAGAGGGAGGCCCAGCGGGTGG + Intronic
1144223158 17:13118520-13118542 GTTTAGGGAGGGGCTGAGTAGGG - Intergenic
1145208133 17:20995401-20995423 CTTGAGGAAGGGTCTGCAGAGGG + Intergenic
1145208600 17:20997300-20997322 GGTGAGGGAGGGCGTGAGGCAGG + Intergenic
1146409634 17:32571331-32571353 GTGGAGGGAGGGCCAGAGGCGGG - Intronic
1146927561 17:36755468-36755490 GTTGGGGGAGGGGGTGCAGAGGG + Intergenic
1147935376 17:44007699-44007721 GCTGTGGGAGTGCCTGCGGCGGG + Exonic
1148122286 17:45220541-45220563 GAGGAGGGAGGGCCCGCTGAAGG - Intergenic
1148161721 17:45453973-45453995 GGTGCGGGAGGCCCTGCAGAAGG - Exonic
1148218925 17:45849087-45849109 GCTGAGCCAGGGCCTGCGGAGGG - Intergenic
1150392956 17:64800618-64800640 GGTGCGGGAGGCCCTGCAGAAGG - Intergenic
1150810948 17:68356820-68356842 GCAGGGGGAGGCCCTGCGGAGGG - Intronic
1151979154 17:77498706-77498728 GTGGTGGGAGGGCCTGGGGGGGG - Exonic
1152048340 17:77953611-77953633 GGTGAGGAAGGGACTGTGGAAGG - Intergenic
1152168239 17:78724757-78724779 GTGGAGGCAGGGCTTGCAGAGGG - Intronic
1152388419 17:79988915-79988937 CCTGAGGGAGGGCCTGGGGCCGG - Intronic
1152557390 17:81060333-81060355 GATGAGGGAGGGACTGCTTAAGG - Intronic
1152569858 17:81116898-81116920 GTTGAGAGCTGGCCAGCGGAGGG + Exonic
1152628228 17:81398211-81398233 GTCCAGGGAGCGCCTTCGGAGGG + Intronic
1152636563 17:81432769-81432791 GGGGAGGGTGGGCCTGGGGATGG - Intronic
1152636588 17:81432818-81432840 GGGGAGGGTGGGCCTGGGGATGG - Intronic
1152694787 17:81738699-81738721 GTCGAGGGAGGGCCGGGAGACGG - Intergenic
1152756149 17:82087875-82087897 GGTGCGGAAGGGCCTGAGGACGG + Intronic
1153825806 18:8873793-8873815 GGTGAGGAGGGGCCTGCCGAGGG + Intergenic
1155242519 18:23877128-23877150 GATGAGGGAGGTCGTGGGGAAGG + Intronic
1155521729 18:26675092-26675114 GTTGTGGGAGGGACTGAGGGAGG + Intergenic
1156486770 18:37471443-37471465 GTTCAGGAAGGGCTTGGGGACGG - Intronic
1160396778 18:78578069-78578091 GATCAGGGAGGACCTGGGGAAGG + Intergenic
1160818396 19:1046745-1046767 GCGGAGGGGGGGTCTGCGGAGGG + Intronic
1161174083 19:2829846-2829868 GCTGAAGGAGGGGCTGGGGAGGG - Intronic
1161588288 19:5117327-5117349 GTGGAGGGAGGGACTGCAGTGGG + Intronic
1162333764 19:10047256-10047278 GTTGGGGGAGGGGCTGGGTAAGG - Intergenic
1162547424 19:11339187-11339209 CTTGAGGGAGGGTCGGCAGATGG - Intronic
1162587590 19:11570231-11570253 GTTGAGGGTGGGCCAAAGGAGGG + Intronic
1165091758 19:33391573-33391595 GTGGTGGGAGGGCCTGAGGTGGG + Intronic
1165161712 19:33820441-33820463 GGGGAGGGAGGGCTGGCGGAAGG + Intergenic
1165831813 19:38734275-38734297 GGTGAGGGAGGGAGTGGGGAAGG - Intronic
1165924913 19:39320850-39320872 GTGGGGGGAGGGCCGGGGGAGGG + Intergenic
1166103844 19:40588012-40588034 ATTCAGGGAAGGCCTGAGGAAGG + Intronic
1166118450 19:40670064-40670086 GTAGAGGGCGGGGCTGCGGCAGG - Intronic
1166447303 19:42869317-42869339 GATTAGGGAGGGCCTGGGAAGGG - Intronic
1166455009 19:42933615-42933637 TTAGAGGGAGTGTCTGCGGAAGG + Intronic
1166932334 19:46308732-46308754 GTTGAGGGTGCGCCCGCGGCTGG - Exonic
1168689084 19:58366256-58366278 GATGAGGGAGGCCCTGCCCATGG - Intergenic
925454483 2:4003435-4003457 CTTGAGGGAAGGCTTGTGGATGG - Intergenic
925667580 2:6277088-6277110 GGTGAGGGAGGGCAGGGGGAGGG + Intergenic
925672459 2:6325922-6325944 GTGGGAGGAGGGCCGGCGGAGGG - Intergenic
926094801 2:10074099-10074121 GCTGAGGGAGAGCGTGTGGATGG - Intronic
926115197 2:10208855-10208877 GATGGGTGAGGGGCTGCGGAGGG - Intronic
926199611 2:10784947-10784969 GTTGAGAGAGAGCCTTGGGACGG - Exonic
927093178 2:19727944-19727966 GTGGAGGGAGCCCCTGGGGAAGG - Intergenic
927266949 2:21162382-21162404 GCTGAGGGAGGGGCTGAGGGTGG - Intergenic
927633552 2:24794285-24794307 CTTGAGGGAGGGCCAGTGTAGGG + Intronic
927638873 2:24834463-24834485 GGTGAGGGAGGGGCCGGGGAGGG - Exonic
928254662 2:29711632-29711654 GTTGTGGGAGGGCCTCTGAAGGG + Intronic
930610676 2:53539527-53539549 GTTGAGGGAGGGCCTCATGGAGG - Intronic
935831449 2:107004974-107004996 GCTGAGGGAGGGGCTGAGGGAGG + Intergenic
935831454 2:107004986-107005008 GCTGAGGGAGGGGCTGAGGGAGG + Intergenic
936141797 2:109947623-109947645 GCTGCGGGTGGGCCTGCGGGCGG - Intergenic
936178485 2:110245571-110245593 GCTGCGGGTGGGCCTGCGGGCGG - Intergenic
936202893 2:110423861-110423883 GCTGCGGGTGGGCCTGCGGGCGG + Exonic
937650141 2:124310521-124310543 GTTAAGGGAGGGCTTGGGCACGG - Intronic
938823716 2:134983615-134983637 GTGGAGGGAGGGACTGTGGGGGG + Intronic
944522513 2:200586427-200586449 GTTTAGGGAGGGCGTGTGGTTGG - Intronic
948489158 2:238300749-238300771 GCTGAGTGAGGGCCTGGGTAGGG + Intergenic
1169208633 20:3753769-3753791 GGAGAGGGAGGGCCTGGGGTGGG - Exonic
1170297899 20:14849479-14849501 GCTGAGAGAGGGCTTGAGGAAGG - Intronic
1171046079 20:21810123-21810145 GACCAGGGAGGGGCTGCGGATGG + Intergenic
1172176604 20:32976281-32976303 GTTGGAGGAGGGCCCGTGGATGG + Intergenic
1173946181 20:46952662-46952684 GGTGCGGGGTGGCCTGCGGAGGG - Intronic
1175036692 20:56006156-56006178 ATTGAGGGAGGTCCTTGGGATGG + Intergenic
1175328747 20:58148190-58148212 GTTGAAGGAGAGGCTGTGGATGG - Intergenic
1175892421 20:62321562-62321584 GTGGAGGCAGGGCCTGTGGAGGG + Intronic
1176061351 20:63174243-63174265 GTGGAGGGAGCACCTGCAGATGG + Intergenic
1178906305 21:36639825-36639847 GTTGAGAGAGGGCTTGCTGTTGG - Intergenic
1180696473 22:17754324-17754346 TTGGAGGGGAGGCCTGCGGAGGG - Intronic
1180782431 22:18528722-18528744 GGTGAGGCAGGGCGGGCGGAAGG + Intronic
1182095270 22:27621555-27621577 GCTCAGGCAGGGCCTGGGGAAGG - Intergenic
1182439991 22:30357432-30357454 CTTGAGGGCGGGACTACGGAAGG - Intronic
1183370176 22:37427636-37427658 GCTGCGGAAAGGCCTGCGGAGGG - Intergenic
1183385207 22:37510211-37510233 GTTGCAGGAGGGCCTGCAGCAGG - Exonic
1183581772 22:38730706-38730728 GGTGAGGGTGGGCCAGGGGAAGG - Exonic
1183830895 22:40417906-40417928 GCTGAGAGAGGGTCTGCTGAGGG + Intronic
1183920032 22:41158543-41158565 GTCCAGGGAGTGCATGCGGATGG + Intronic
1184381012 22:44144995-44145017 CTTGGGGGAGGGCCTGGAGAGGG - Intronic
1184416310 22:44353705-44353727 GGTGAGGTAGGGACTGCAGAGGG - Intergenic
1185192256 22:49446390-49446412 GGAGAGGGAGGGCCTGCTGAGGG - Intronic
950138707 3:10600815-10600837 GCTGAGTGAGGGCATGGGGAGGG + Intronic
950306246 3:11917128-11917150 GCTGAGGGGGAGCCGGCGGAGGG + Intergenic
950374140 3:12556672-12556694 GTTGAGGCAGGGCCTGAGAAGGG + Intronic
951864144 3:27288485-27288507 GGTGAGGGAGGGTCAGTGGATGG - Intronic
952062325 3:29525447-29525469 CTTGATGGAGGGCCAGCTGAAGG - Intronic
952336184 3:32404983-32405005 GTTGAGAGAGGGCCTGTGAGGGG + Intronic
953357021 3:42264760-42264782 GTTCAGGGAGGACCAGCGGGCGG + Exonic
953902642 3:46851927-46851949 GGTGAGGGAGGGACTGGGGCTGG + Intergenic
954366026 3:50146669-50146691 GGTGAGGAAGGGATTGCGGAGGG - Intergenic
961044404 3:123698882-123698904 GGTGAGGGAGGGAGTGGGGAGGG + Intronic
961049643 3:123735476-123735498 GATGAGGAAGTGCCTGGGGAGGG - Intronic
961620158 3:128217595-128217617 GTTCAGGCAGGCCCTGGGGAAGG - Intronic
962236334 3:133710636-133710658 GTAGAGGGATTGGCTGCGGAGGG - Intergenic
968045543 3:195622298-195622320 GTTGAGGCCTGGCCTGGGGAAGG + Intergenic
968045555 3:195622332-195622354 GTTGAGGCCTGGCCTGGGGAAGG + Intergenic
968045566 3:195622367-195622389 GTTGAGGCCTGGCCTGGGGAAGG + Intergenic
968045579 3:195622401-195622423 GTTGAGGCCTGGCCTGGGGAAGG + Intergenic
968045590 3:195622436-195622458 GTTGAGGCCTGGCCTGGGGAAGG + Intergenic
968045602 3:195622470-195622492 GTTGAGGCCTGGCCTGGGGAAGG + Intergenic
968064353 3:195750353-195750375 GTTGAGGCCTGGCCTGGGGAAGG + Intronic
968509495 4:989170-989192 GGTGAGGGAGGCCCTGCCCAGGG - Exonic
968748342 4:2372634-2372656 GATGAGGGAGGGCCTGCGGCTGG + Intronic
969261326 4:6036014-6036036 GCTGAGCGAGGGCCAGCGGGAGG - Exonic
969327678 4:6453215-6453237 GTTGAGGGAGGGCCCACCGCAGG + Intronic
970826176 4:20278817-20278839 GTGGGGGGAGGGCGTGTGGAGGG + Intronic
971087547 4:23296385-23296407 GTTGAGGGGGGGGCGGAGGATGG + Intergenic
971114535 4:23629535-23629557 GTTGAGGGAGGGCCCCTGGTGGG + Intergenic
983732524 4:171012965-171012987 TTGGAGGTAGGGCCTGAGGAGGG + Intergenic
983983578 4:174029336-174029358 GGTGAGGTAGGGCTTGGGGAAGG + Intergenic
987083850 5:14450408-14450430 TTTGTGGGAGGGGCTGCGCAGGG + Intronic
990711134 5:58582102-58582124 CCTGGGGGAGGGCCTGGGGAGGG + Intergenic
992151594 5:73909768-73909790 GCTGAGGGAGGGCCAGCGCCTGG + Exonic
993110143 5:83646704-83646726 GGTGAGGGAAGGCCTGGAGATGG + Intronic
993502467 5:88678734-88678756 GTGGAGAGAGGGTCTGCTGAGGG + Intergenic
995106225 5:108380988-108381010 GGCGGGGGAGGGCCTGCGGGGGG - Exonic
995887500 5:116912643-116912665 GTTTAGGGCGGACCTGTGGATGG + Intergenic
998097182 5:139402709-139402731 GCTGAGGGAGGGCCTGGGGCTGG + Intronic
1003513655 6:6801739-6801761 CTTGAGGGAGGCCATGGGGATGG + Intergenic
1004424242 6:15496898-15496920 CTTGGCGGAGGGCCTGAGGACGG - Exonic
1005819094 6:29582452-29582474 GTAGAGGGAGAGCCTTCAGATGG + Intronic
1006340959 6:33446786-33446808 GGTGAGGGGCGGCCTGGGGAGGG + Exonic
1006474311 6:34244969-34244991 GGTGATGGTGGGCCTGGGGAAGG - Exonic
1007167933 6:39841410-39841432 GGTGGGGGAGGGCCTCCAGAGGG + Intronic
1007791702 6:44312898-44312920 GTATAGGGAGGGCTTGGGGAGGG - Intronic
1007951436 6:45876061-45876083 GTGGAGGGTGGGGCTGCAGAGGG + Intergenic
1008342947 6:50389559-50389581 GTTGGGGGAGGGACTTCGGTGGG + Intergenic
1012442152 6:99270626-99270648 GTTGAGGGAGGGGCTGAGTGTGG - Intergenic
1013418956 6:109949076-109949098 GGAGTGTGAGGGCCTGCGGAAGG + Intergenic
1015903577 6:138092877-138092899 GTGGAGGGAGGGCAGGGGGAAGG + Intronic
1016008193 6:139110872-139110894 GTATAGGGAGGGCCTGTGGTGGG - Intergenic
1017252619 6:152297380-152297402 GTTGTGGGAGGGCCTAGAGAAGG - Intronic
1017985748 6:159441893-159441915 GTAGAGAGAGGCTCTGCGGAGGG - Intergenic
1018894506 6:168004301-168004323 GTTGAGGGAGTGCCTGCCGTGGG - Intronic
1019140311 6:169938461-169938483 GGGGAGGGAGAGCCTGGGGAGGG + Intergenic
1019367850 7:644510-644532 GTGGAGGGTGGGCCCTCGGAGGG - Intronic
1019499039 7:1355300-1355322 CGGGAGGGAAGGCCTGCGGATGG + Intergenic
1019614142 7:1951281-1951303 GTGGATGAAGGGCCTGAGGAAGG + Intronic
1020274904 7:6617917-6617939 GCTGAGTGAGGGCCTGGGGCAGG + Intronic
1021654790 7:22864389-22864411 GTGGAGTGAGGGGCTGTGGATGG - Intergenic
1022327781 7:29347626-29347648 GTTGAGGGAGGGACCCCGGTAGG - Intronic
1022410685 7:30136273-30136295 GTTGAGGAAGGGGATGCGGAGGG + Intronic
1023820423 7:43977533-43977555 GCTGAGGGATGGGCTGCGAATGG + Intergenic
1023842240 7:44104236-44104258 GTGGACGGAGGGGCTGCGGGGGG - Intergenic
1024084396 7:45881496-45881518 GTTGGTGTAGGGCCTGGGGATGG + Intergenic
1024610495 7:51059990-51060012 ATGAAGGGAGGGCCTGTGGAGGG - Intronic
1024991948 7:55241768-55241790 GTACAGGGAGGGCTTGCGGCAGG + Intronic
1026952459 7:74356623-74356645 GGTGAGGGTGGGGCTGCAGAAGG + Exonic
1028472970 7:91224423-91224445 GTTCAGGGAGGATCTGGGGATGG + Intergenic
1029507106 7:100969104-100969126 GTTGAGGCAGGGGATGGGGAAGG + Intergenic
1029821139 7:103149012-103149034 GATGAGGGAGGGCTCGGGGACGG + Intronic
1034343838 7:150373743-150373765 GGTGATGGAGGGCCAGCTGAGGG + Intronic
1035771895 8:2154313-2154335 GGTGAGGCAGGGCCTGAGAAAGG + Intronic
1035823262 8:2617475-2617497 GTCGAGGGCGGGGCTGCAGAAGG - Intergenic
1036088081 8:5635545-5635567 GTTGTGGGAGGGACTGTGGGAGG - Intergenic
1037701849 8:21282666-21282688 GTTGAGGAAGCTCCTGAGGAAGG - Intergenic
1037815608 8:22110109-22110131 GATGAGGGTGGGCCGGCTGACGG - Intergenic
1037821168 8:22135348-22135370 GGTGAGGGAGTGCTTGCGGAGGG + Intergenic
1040436776 8:47398820-47398842 GTGGAGGGAGAGACTGCTGAGGG + Intronic
1041491280 8:58436589-58436611 GTTGGGGGTGGGCCTGTGGGAGG + Intronic
1042477560 8:69266272-69266294 GGTGAGAGAAGGCCTGAGGAGGG + Intergenic
1044971989 8:97628769-97628791 GGTAAGGGAGTGCCTGCGGGTGG - Intergenic
1046997552 8:120541291-120541313 GTGGAGAGAGGGCCAGAGGAGGG - Intronic
1047198105 8:122740103-122740125 GGGGAGGGAGGGCATGTGGACGG - Intergenic
1047250334 8:123177481-123177503 GTTGAGGGAATGCCTGCACAGGG - Intergenic
1048295855 8:133212854-133212876 CTGGAGAGAGGGCCTGCGGGGGG - Exonic
1049369549 8:142257325-142257347 GCTCAGGAGGGGCCTGCGGAGGG + Intronic
1049606627 8:143532609-143532631 GCTGAAGGAGGGCCTGGGAAGGG + Intronic
1050606378 9:7305656-7305678 GTGGAGAGAGGGCCTGTGAATGG - Intergenic
1051774915 9:20622549-20622571 GCGGAGGGAGGGCTTGCGGGCGG + Intergenic
1053575476 9:39354907-39354929 GTCGAGGGAGGGCCGGTGGTAGG + Intergenic
1054097037 9:60913590-60913612 GTCGAGGGAGGGCCGGTGGTAGG + Intergenic
1054118444 9:61189217-61189239 GTCGAGGGAGGGCCGGTGGTAGG + Intergenic
1054589312 9:66993347-66993369 GTCGAGGGAGGGCCGGTGGTAGG - Intergenic
1054714979 9:68548049-68548071 GGTGAGGGATGGCTTGCTGAAGG + Intergenic
1059465398 9:114466245-114466267 GGTGAGGGAGGGCCTGAGGGAGG - Exonic
1060029652 9:120203388-120203410 GTTGTGGGAGGGGGTGCCGAGGG - Intergenic
1060727273 9:126014952-126014974 GGTGGGGGAGGGGCTGGGGATGG - Intergenic
1061381570 9:130261836-130261858 GCTGAGGGAGCACCTGAGGAGGG + Intergenic
1061959635 9:133981467-133981489 GCTGAGGGAGGGCAGGCGGCGGG + Intronic
1062035577 9:134381155-134381177 GTTGAGGGAGGCCCTGGAGAGGG + Intronic
1062363745 9:136199246-136199268 GTGGAGGGGGCGCCGGCGGAGGG + Intronic
1062689149 9:137832517-137832539 GTGGGGGGAGGGCCTGCGGAGGG - Intronic
1186192367 X:7077820-7077842 GTTCAGCGAGGCCCTGCTGAAGG - Intronic
1187656563 X:21481750-21481772 GTTGTGAGAGGGCCTGTGTAGGG + Intronic
1188156424 X:26748440-26748462 GGTGATGGTGGGCCTGGGGAAGG - Intergenic
1194496547 X:94622926-94622948 GTTGGGGGAGGGCATGAGGTGGG + Intergenic
1197871818 X:131068620-131068642 GCTGAGGGTGGGGGTGCGGAGGG - Intronic
1198059111 X:133025946-133025968 TTTGAGGCAGTGCCTGCTGAGGG + Exonic
1199440072 X:147857815-147857837 GTTGAGGGAGACCCGGCGGGTGG - Intergenic
1199982880 X:152930539-152930561 GTTGAGAGTGGGCCTCCTGAGGG + Intronic
1200144710 X:153920650-153920672 CTTGAGGGAGCTCTTGCGGAGGG + Exonic