ID: 1122597069

View in Genome Browser
Species Human (GRCh38)
Location 14:102901158-102901180
Sequence AGGACTCCCCCACACAGCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 1, 2: 3, 3: 16, 4: 174}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122597069_1122597077 12 Left 1122597069 14:102901158-102901180 CCCCTGCTGTGTGGGGGAGTCCT 0: 1
1: 1
2: 3
3: 16
4: 174
Right 1122597077 14:102901193-102901215 CCCGTTCTGTGCTTGAGGTCAGG 0: 1
1: 0
2: 0
3: 3
4: 100
1122597069_1122597074 7 Left 1122597069 14:102901158-102901180 CCCCTGCTGTGTGGGGGAGTCCT 0: 1
1: 1
2: 3
3: 16
4: 174
Right 1122597074 14:102901188-102901210 GACTCCCCGTTCTGTGCTTGAGG 0: 1
1: 0
2: 0
3: 14
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122597069 Original CRISPR AGGACTCCCCCACACAGCAG GGG (reversed) Intronic