ID: 1122597916

View in Genome Browser
Species Human (GRCh38)
Location 14:102905906-102905928
Sequence GGCGGACGCGTGCCGGCGGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 156}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122597910_1122597916 4 Left 1122597910 14:102905879-102905901 CCTTGTGAGACGGAGGAAGCGGC 0: 1
1: 0
2: 0
3: 3
4: 86
Right 1122597916 14:102905906-102905928 GGCGGACGCGTGCCGGCGGGAGG 0: 1
1: 0
2: 1
3: 18
4: 156
1122597906_1122597916 23 Left 1122597906 14:102905860-102905882 CCTCGCGCTCAGAAAAGGACCTT 0: 1
1: 0
2: 1
3: 4
4: 56
Right 1122597916 14:102905906-102905928 GGCGGACGCGTGCCGGCGGGAGG 0: 1
1: 0
2: 1
3: 18
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122597916 Original CRISPR GGCGGACGCGTGCCGGCGGG AGG Exonic