ID: 1122600309

View in Genome Browser
Species Human (GRCh38)
Location 14:102918045-102918067
Sequence GAGGAAGGAGCCGCCACTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122600309_1122600320 30 Left 1122600309 14:102918045-102918067 CCCCCAGTGGCGGCTCCTTCCTC No data
Right 1122600320 14:102918098-102918120 GCAAATACCAGGCCAAGCAAAGG No data
1122600309_1122600319 19 Left 1122600309 14:102918045-102918067 CCCCCAGTGGCGGCTCCTTCCTC No data
Right 1122600319 14:102918087-102918109 TCATGAAAGAAGCAAATACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122600309 Original CRISPR GAGGAAGGAGCCGCCACTGG GGG (reversed) Intergenic
No off target data available for this crispr