ID: 1122602506

View in Genome Browser
Species Human (GRCh38)
Location 14:102928648-102928670
Sequence GTCCCGAAGCGGGGCTTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 105}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122602491_1122602506 25 Left 1122602491 14:102928600-102928622 CCGGAGGGAGGGCGCCTCCGGGG 0: 1
1: 0
2: 3
3: 16
4: 157
Right 1122602506 14:102928648-102928670 GTCCCGAAGCGGGGCTTGGGAGG 0: 1
1: 0
2: 1
3: 9
4: 105
1122602497_1122602506 11 Left 1122602497 14:102928614-102928636 CCTCCGGGGGCGTGGTTTAGGGA 0: 1
1: 0
2: 0
3: 2
4: 40
Right 1122602506 14:102928648-102928670 GTCCCGAAGCGGGGCTTGGGAGG 0: 1
1: 0
2: 1
3: 9
4: 105
1122602498_1122602506 8 Left 1122602498 14:102928617-102928639 CCGGGGGCGTGGTTTAGGGAGTG 0: 1
1: 0
2: 0
3: 8
4: 127
Right 1122602506 14:102928648-102928670 GTCCCGAAGCGGGGCTTGGGAGG 0: 1
1: 0
2: 1
3: 9
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122602506 Original CRISPR GTCCCGAAGCGGGGCTTGGG AGG Intronic
903735778 1:25529096-25529118 GGCCTGAAGCGGGGGTTGGGGGG + Intergenic
904623767 1:31790798-31790820 GTGCCGGAGCAGGGCTTGGTGGG + Exonic
907246958 1:53114725-53114747 GTTCCCAAGCGGGGTGTGGGTGG + Intronic
907305302 1:53509794-53509816 GTCCCTAAGTGGGAATTGGGGGG + Intronic
923596867 1:235367300-235367322 GCCCAGAGGCGGGGCTTGGGTGG + Intergenic
1067029601 10:42871362-42871384 GTCCCAGAGCCGGGCGTGGGTGG - Intergenic
1074902514 10:117831240-117831262 GTCCCGAAGTGGGGCTGCGTGGG + Intergenic
1075777775 10:124999250-124999272 GTCCCAAAGCTGGGATTAGGAGG - Intronic
1076905113 10:133357602-133357624 GTCCCGGGGCAGGGGTTGGGTGG - Intronic
1077444592 11:2585070-2585092 GGCCCGAGGTGGGACTTGGGGGG + Intronic
1082811698 11:57482595-57482617 GTCCCGCGGCGGGGGTTTGGGGG + Intergenic
1083276359 11:61599262-61599284 GGGCAGAAGCGGGGCATGGGTGG - Intergenic
1084199153 11:67543708-67543730 GTCCCCAAGCAGGGCTAGGAAGG - Intergenic
1084456878 11:69273111-69273133 GCCCAGGAGCTGGGCTTGGGTGG - Intergenic
1084494161 11:69494521-69494543 GTCCTGCAGCAGGGCTGGGGTGG - Intergenic
1089177827 11:116561138-116561160 GCCCCTAAGCGGGGCCAGGGTGG + Intergenic
1091781379 12:3216429-3216451 TTCTGGAGGCGGGGCTTGGGAGG + Intronic
1091985989 12:4910496-4910518 ATGCAGAAGCGGGGGTTGGGGGG + Intronic
1096208291 12:49741812-49741834 GTGCTGAAGCGGGGGTGGGGCGG + Exonic
1096793634 12:54060580-54060602 GTCACGACCCCGGGCTTGGGCGG + Intergenic
1097661424 12:62435439-62435461 GTACCCAGGCGGTGCTTGGGCGG + Intergenic
1098011935 12:66062232-66062254 GTGCCGAAGAGGGAGTTGGGAGG + Intergenic
1099015815 12:77342868-77342890 GTACGGAAGCGGGGGTGGGGTGG - Intergenic
1102527078 12:113519940-113519962 GGCCCGAGGGGCGGCTTGGGAGG + Intergenic
1103443431 12:120979533-120979555 GGCCCGAAGCTGGGGTTTGGGGG + Intronic
1103561045 12:121793469-121793491 GGCCCGCAGCGGGGCTGGGGTGG - Intronic
1103567447 12:121823569-121823591 GGCCGGAAGAGGGGCTGGGGTGG - Exonic
1104864432 12:131944559-131944581 GTCCCGAGGCAGGGCTGTGGAGG + Exonic
1107891093 13:44915390-44915412 GTCAAGGAGCGGGGCTTAGGGGG - Intergenic
1109446535 13:62447846-62447868 ATCCCGAAGCAGGGATGGGGTGG + Intergenic
1111842041 13:93461656-93461678 GTCCCGGCGGGGGGGTTGGGGGG + Intronic
1112502738 13:99955376-99955398 GTCCTGGAGCGGGGGTGGGGAGG - Intergenic
1116325846 14:43533315-43533337 GTGGGGAGGCGGGGCTTGGGCGG - Intergenic
1117297791 14:54394824-54394846 CTCCCGAAGCGTGGCTAGAGTGG + Intergenic
1120730140 14:87992795-87992817 GGCCCGCTGCGGGGCTGGGGCGG - Intronic
1121520263 14:94581346-94581368 GTCCCGGGGCGGGGCCAGGGAGG + Intronic
1122151891 14:99730210-99730232 GTCCCGAGGCGCGGAGTGGGTGG + Intergenic
1122602506 14:102928648-102928670 GTCCCGAAGCGGGGCTTGGGAGG + Intronic
1122746331 14:103899214-103899236 GGCCCAAAGCAGGTCTTGGGTGG + Intergenic
1123458584 15:20447184-20447206 GTCCCAAAGGTGGGCTGGGGTGG + Intergenic
1123659479 15:22553225-22553247 GTCCCAAAGGTGGGCTGGGGTGG - Intergenic
1124264874 15:28223354-28223376 GTCCCAAAGGTGGGCTTGGGCGG + Intronic
1124313340 15:28647720-28647742 GTCCCAAAGGTGGGCTGGGGTGG - Intergenic
1131461766 15:92622593-92622615 CCCCCGAGGAGGGGCTTGGGGGG + Intronic
1132640756 16:977327-977349 CTCCCGAAGGGGGTCTTGAGAGG + Intronic
1132880557 16:2160055-2160077 TTGCCGAAGAGGGGCTGGGGTGG + Intronic
1134132185 16:11657377-11657399 GTCCCCAAGGAGGTCTTGGGAGG + Intergenic
1135234389 16:20741926-20741948 GGCAGGAGGCGGGGCTTGGGCGG - Exonic
1144563861 17:16343975-16343997 GCCCTGAAGCGGGGCTTGGAGGG + Intronic
1147634256 17:41953413-41953435 GTCTCAAAGCAGTGCTTGGGAGG + Intronic
1148052214 17:44774974-44774996 GTCTCCATGCGAGGCTTGGGCGG - Intronic
1148741431 17:49895201-49895223 GTCGCCAACCCGGGCTTGGGTGG + Intergenic
1150228768 17:63538543-63538565 GTCCCCAGGCGGCGCGTGGGTGG - Exonic
1151356352 17:73560929-73560951 GTCAGGAAGCGGGGCGTGTGGGG + Intronic
1156266920 18:35497663-35497685 GTCGCGAAACGGGACTTGGCGGG - Intronic
1160709981 19:547040-547062 GTCCTGGAGAGGGGATTGGGAGG + Intronic
1162061267 19:8096881-8096903 GTCGCCAGGCGGGGCTTGTGTGG - Exonic
1163023507 19:14496134-14496156 CTCCCGCAGCGGCGCCTGGGGGG + Intronic
1163313419 19:16527349-16527371 GTCCTGAAGCTGGGGATGGGAGG + Intronic
1163354316 19:16799957-16799979 GGCCCGCGGCGGGGCTTTGGTGG + Exonic
1166087742 19:40488095-40488117 GTTGCGAGGCGGGGCTTCGGTGG + Intronic
1166666341 19:44682671-44682693 GCCCCGAAGCCGGGGTGGGGAGG + Intronic
925023198 2:587917-587939 GGCGTGATGCGGGGCTTGGGTGG - Intergenic
935597611 2:104891587-104891609 ATCCTGAAGAGGGGCTTCGGTGG + Intergenic
937271308 2:120654706-120654728 GCTGCGAAGCGGGGCTTGGTGGG - Intergenic
937283208 2:120734905-120734927 CACCCGAAGAGGGTCTTGGGGGG - Intergenic
941102951 2:161317470-161317492 GACTGGAAGCGGGGCTTGGGTGG + Intronic
948384113 2:237571089-237571111 GTCCCGAAACGGGGCTGGGGTGG - Intergenic
948807005 2:240457346-240457368 AACCCGAATCCGGGCTTGGGCGG - Intronic
1173222039 20:41138507-41138529 GTCCCAAAGCTGGGTTTTGGAGG + Intronic
1173570316 20:44071619-44071641 GCCCTGGAGTGGGGCTTGGGTGG - Intergenic
1179717947 21:43299642-43299664 GTCCCACAGCTGGGCTTGGGAGG + Intergenic
1179996771 21:44977795-44977817 GTCCTGCAGCGGGGCTGGGCAGG + Intergenic
1185313829 22:50170455-50170477 AGCCCGCAGCGGGGTTTGGGGGG - Intergenic
949541628 3:5036922-5036944 ATCCAGAAGTGGGGGTTGGGTGG + Intergenic
950665385 3:14492055-14492077 GTCCCCAAGGGGGCCTTGGTGGG + Exonic
950918272 3:16667204-16667226 GTCCCGAAGTGGGGATGAGGAGG + Intronic
954224164 3:49171970-49171992 GTCCAGAAGTGGGGTTGGGGCGG - Intronic
962345683 3:134617752-134617774 GTCCTGGAGCGGGGCCTGGAAGG + Intronic
969053362 4:4387429-4387451 GGCCCGATGCGGGGGTCGGGTGG - Intronic
970303269 4:14703626-14703648 GTCACGAAGTGGGGCTGAGGAGG + Intergenic
982424638 4:155244261-155244283 ATACCTAAGCGGGGGTTGGGAGG - Intergenic
982605860 4:157515394-157515416 CTCCCTAAGCGGGGTTTGTGGGG + Intergenic
982610948 4:157574406-157574428 GTCCCCAGCCAGGGCTTGGGTGG - Intergenic
987108752 5:14665029-14665051 CTCCGGAAGCCGGGCTGGGGTGG + Intronic
992487644 5:77211084-77211106 GTCCCGACGCGCGGCTCGGGGGG - Exonic
1001291356 5:170464804-170464826 GTCCCTAAGCCAGGCTTTGGGGG - Intronic
1001704787 5:173733992-173734014 GCGCCGGAGCCGGGCTTGGGAGG + Intergenic
1002064931 5:176647295-176647317 GTCCAGAGGCGGGGCTCAGGCGG + Intergenic
1002296191 5:178232611-178232633 GGCCCGGAGCGGGGCCTTGGAGG - Exonic
1002447926 5:179301533-179301555 GTCCCAGTGCGGGGCTGGGGAGG - Intronic
1004525135 6:16400350-16400372 GCCCTGAACAGGGGCTTGGGAGG - Intronic
1006027875 6:31158726-31158748 GATCCGAAACGGGGCTGGGGCGG + Intronic
1006939478 6:37742469-37742491 GTCCCCCAGCTGGGCTGGGGTGG - Intergenic
1010980617 6:82365119-82365141 GTCCGGCAGCGGGGGCTGGGCGG - Exonic
1017235565 6:152114092-152114114 GTGCCCAAGCCAGGCTTGGGTGG + Intronic
1018613172 6:165662571-165662593 GGCCCCCAGCGGGGCTGGGGCGG + Intronic
1019024903 6:168951224-168951246 ATCCCGAAGCAGGGCTGTGGTGG + Intergenic
1019809935 7:3157951-3157973 GTCCCCAAGCGACTCTTGGGAGG - Intronic
1022936834 7:35186628-35186650 GGCCCGAAGCGGTGCAGGGGCGG - Intergenic
1023935829 7:44739152-44739174 GTCCTGGAGTGGGGCATGGGTGG + Intergenic
1029833068 7:103280727-103280749 GGCCCGAAGCGGTGCAGGGGCGG - Intergenic
1031885116 7:127238460-127238482 TTCCCAGAGAGGGGCTTGGGAGG + Intronic
1033421530 7:141208608-141208630 GGCCTGAAGCGGGGCTGTGGTGG + Intronic
1035747637 8:1973768-1973790 GACCCGCAGCGGGGCGTGGGCGG - Intergenic
1036477147 8:9103662-9103684 GGCCAGAAGAGGGGCTTGGAGGG + Intronic
1037778333 8:21850152-21850174 GTTAGGAAGTGGGGCTTGGGGGG + Intergenic
1039476442 8:37841610-37841632 GGCCCGGGGCGGGGCATGGGGGG - Exonic
1049812680 8:144582523-144582545 GGCCTGAAGGAGGGCTTGGGTGG - Intronic
1050382104 9:5041770-5041792 GTCCCGAAGCTGAGGCTGGGAGG - Intronic
1061147730 9:128809452-128809474 GGCCCAAAGCCGGGCTTGGAAGG - Exonic
1061438190 9:130579797-130579819 ATCCCGAGGCGGGGCCTGGCGGG + Intronic
1062364222 9:136201429-136201451 GTACCGAAGTGGGGTGTGGGGGG - Intronic
1186008329 X:5100227-5100249 GACAGGAGGCGGGGCTTGGGCGG - Intergenic
1191253271 X:58269265-58269287 GGCCCGATGCAGGGCTTGGTGGG + Intergenic
1201900750 Y:19044519-19044541 GTAACTAAGAGGGGCTTGGGTGG - Intergenic