ID: 1122608342

View in Genome Browser
Species Human (GRCh38)
Location 14:102963439-102963461
Sequence CCTCTGTTCTTCAGGGACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 512
Summary {0: 1, 1: 0, 2: 2, 3: 40, 4: 469}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122608333_1122608342 21 Left 1122608333 14:102963395-102963417 CCTAATGGAGCTCTTGACCTTCC 0: 1
1: 0
2: 3
3: 14
4: 125
Right 1122608342 14:102963439-102963461 CCTCTGTTCTTCAGGGACACAGG 0: 1
1: 0
2: 2
3: 40
4: 469
1122608335_1122608342 4 Left 1122608335 14:102963412-102963434 CCTTCCTAATCTTGTTCCCAGGC 0: 1
1: 0
2: 0
3: 12
4: 165
Right 1122608342 14:102963439-102963461 CCTCTGTTCTTCAGGGACACAGG 0: 1
1: 0
2: 2
3: 40
4: 469
1122608336_1122608342 0 Left 1122608336 14:102963416-102963438 CCTAATCTTGTTCCCAGGCGAGT 0: 1
1: 0
2: 0
3: 4
4: 96
Right 1122608342 14:102963439-102963461 CCTCTGTTCTTCAGGGACACAGG 0: 1
1: 0
2: 2
3: 40
4: 469

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122608342 Original CRISPR CCTCTGTTCTTCAGGGACAC AGG Intronic
900176204 1:1292499-1292521 ATTCTGTTCTTCAGGGTCACAGG + Exonic
900791374 1:4683201-4683223 CATCTGTCCTTCAGGGGCATGGG + Intronic
900998502 1:6135578-6135600 CCTCTTTTCCTCAGCCACACTGG + Intronic
902655312 1:17863708-17863730 CATCTGTTCTTCAGGGAGTATGG - Intergenic
902863520 1:19262373-19262395 CCTCAGTGCTTCAGGGACCTGGG - Intergenic
902980062 1:20116126-20116148 CGTCTGGCCTTCAGGGACCCTGG + Intronic
903769579 1:25755258-25755280 CCTGGGACCTTCAGGGACACTGG + Intronic
904539449 1:31222984-31223006 CCTCTTTTCTTCAGGGAGGGAGG + Intronic
908331661 1:63076891-63076913 CCTCTTCTCTTCTGGAACACTGG - Intergenic
908567763 1:65375815-65375837 TCTGTGTTCTTCAGTGACACTGG + Intronic
908862231 1:68502218-68502240 TCTATGTTCGTCAGGGATACTGG - Intergenic
909060869 1:70877874-70877896 TCTATGTTCATCAAGGACACTGG + Intronic
911360489 1:96870141-96870163 CCTATGTTCATCAGGGATATTGG + Intergenic
912588851 1:110793542-110793564 CCTATGTTCATCAGGGATATTGG - Intergenic
912877471 1:113375732-113375754 CCTCTCTGCTCCAGGCACACTGG + Intergenic
913297966 1:117340106-117340128 CCTCTGTTCTTGAGGGAAAATGG + Intergenic
914399232 1:147300680-147300702 TCTATGTTCATCAGGGATACTGG - Intergenic
914860010 1:151378028-151378050 CTCCTGTCCTTCTGGGACACTGG - Intergenic
915071141 1:153268575-153268597 TCTGTGTTCATCAGGGACATTGG + Intergenic
915282391 1:154831379-154831401 CCTCAGTTCTACAAGGACCCGGG - Intronic
915350099 1:155218915-155218937 CCTCTATCCTTCAGAGACTCTGG - Intergenic
915353499 1:155241153-155241175 CCTCTATCCTTCAGAGACTCTGG - Exonic
915965046 1:160299255-160299277 CCTCTGTTCTTAGGGACCACGGG - Exonic
917264583 1:173207072-173207094 CCTCTGTAATTCAGGGACTGGGG - Exonic
917317270 1:173738920-173738942 TCTATGTTCATCAGGGATACTGG + Intronic
917355265 1:174120710-174120732 TCTCTGTACTTCAGCCACACTGG - Intergenic
917918527 1:179729019-179729041 TCTCTCCTCTTCAAGGACACAGG + Intergenic
918100869 1:181373064-181373086 CCTATGTTCATCAGGGATATTGG + Intergenic
918265383 1:182837532-182837554 TCTATGTTCATCAGGGATACTGG + Intergenic
918704595 1:187644647-187644669 CATCTGTTCTTCAGAGATGCCGG - Intergenic
918757445 1:188356195-188356217 CCTGTGTTCTTGGGGGACCCAGG - Intergenic
919533917 1:198762451-198762473 CATATCTTCTGCAGGGACACGGG + Intergenic
919634976 1:199995216-199995238 GTTATGTTTTTCAGGGACACTGG + Intergenic
920577943 1:207076166-207076188 CATTTGGTCTTCAGAGACACTGG + Exonic
920889658 1:209971812-209971834 TCTGTGTTCTTCAGGGATATTGG + Intronic
922572108 1:226640305-226640327 AATCTGTTCTTTAGGGACAAAGG + Intronic
923373082 1:233332147-233332169 CTTCTGGGCCTCAGGGACACTGG + Intronic
923731042 1:236550294-236550316 CCTTTGTTCTTTTGGGAAACGGG - Exonic
923960823 1:239081606-239081628 CCTATGTTCATCAGGGATATTGG + Intergenic
924146207 1:241077505-241077527 TCTCTGCTGTTCAGGGACAGTGG + Intronic
1062797320 10:354337-354359 CCACAGGTGTTCAGGGACACTGG + Intronic
1063566331 10:7174647-7174669 TCTGTGTTCTTCCAGGACACTGG - Intronic
1066554507 10:36596554-36596576 CCTCTGCTCCCAAGGGACACAGG - Intergenic
1067345937 10:45439354-45439376 CCACTGTGCTGCAGTGACACTGG + Intronic
1068184392 10:53565725-53565747 CCTCTGTTCTTGAGGGATATTGG - Intergenic
1068876741 10:62005117-62005139 GCTCTGATCTTCAGGGAGAAGGG + Intronic
1069307630 10:66991087-66991109 CATCTGTTCTTCAAGGTCAGAGG - Intronic
1069699406 10:70410456-70410478 TCTGTATTCTTCAGGGAGACAGG - Intronic
1070612198 10:77940973-77940995 CCTCTTTTATTCAGGGAGGCTGG + Intergenic
1070643096 10:78182966-78182988 ACTCTGTCCTTAAGGGACCCCGG + Intergenic
1071023892 10:81089636-81089658 TCTATGTTCTTCAGGGATATTGG + Intergenic
1071558418 10:86625338-86625360 CCTCTGCTCATCAGCTACACTGG + Intergenic
1071775066 10:88777598-88777620 ATTCTGTTCTCCAGGTACACTGG + Intronic
1072248836 10:93566364-93566386 CCTTTATTTTTCAGGGACACTGG - Intergenic
1074340749 10:112626731-112626753 CCACTGCTCTTCAGGTACATTGG + Intronic
1075828420 10:125381403-125381425 TCTATGTTCATCAGGGATACTGG + Intergenic
1076546600 10:131249496-131249518 CCACTGTCCTCCAGGGACTCAGG - Intronic
1076837879 10:133030206-133030228 CTCCTGTTCCTCCGGGACACAGG + Intergenic
1076885202 10:133258952-133258974 CCTATGCACTGCAGGGACACTGG + Intergenic
1077953245 11:6985112-6985134 TCTATGTTCATCAGGGACATTGG - Intergenic
1078030065 11:7741240-7741262 TCTATGTTCATCAGGGACATTGG - Intergenic
1078433740 11:11307773-11307795 CCTCTTTTCTTCATGGTAACTGG + Intronic
1078501988 11:11888766-11888788 CCGATGTTCATCAGGGATACTGG - Intronic
1078549519 11:12270512-12270534 CCTCTGCTGTTGAGGGACAGTGG + Intergenic
1078687003 11:13542155-13542177 CCTGTGTTCATCAGGGATATTGG + Intergenic
1079190300 11:18271564-18271586 CCTCTCTTCTTCAGGAAGATAGG + Intergenic
1081177082 11:39941480-39941502 TCTATGTTCTTCAGGGATACTGG + Intergenic
1081180655 11:39982694-39982716 CCTCTGTTCATCAGGCATATTGG + Intergenic
1081667214 11:44923569-44923591 CCTCTGTGCTTAAGGGAAAGGGG - Intronic
1081814775 11:45932455-45932477 CCTCTGTCCTTCAAGGAGACTGG + Intronic
1083057954 11:59841318-59841340 CCTCTGTCATTCACAGACACAGG - Exonic
1083097934 11:60271300-60271322 CCTCTGTTCATCAAGGATAGTGG + Intergenic
1083496096 11:63055026-63055048 CCTATGTTCATCAGGGATATTGG + Intergenic
1084714124 11:70862964-70862986 CCTCAGTGATTCAGGGACTCAGG + Intronic
1085977392 11:81675665-81675687 TCTATGTTCATCAGGGACATTGG - Intergenic
1086424606 11:86671796-86671818 CCGCGCTTCTTCAGGGGCACAGG + Exonic
1087102257 11:94377039-94377061 CATCTGTTCCTCAGTGACTCAGG - Intergenic
1087127378 11:94641241-94641263 CCTCAGTTCTTCATGGACGTAGG + Intergenic
1087395572 11:97592714-97592736 TCTATGTTCATCAGGGATACTGG - Intergenic
1088425764 11:109700163-109700185 TCTATGTTCTTCAGGGATATTGG - Intergenic
1089267499 11:117275951-117275973 TCTATGTTCATCAGGGATACTGG - Intronic
1089685852 11:120146368-120146390 CCTCTGTCCATCAGAGAAACTGG + Intronic
1090682968 11:129081327-129081349 CATCTGTTCTTCAGGGATATTGG - Intronic
1090688520 11:129152449-129152471 TCTGTGTTCCTCAGGGATACTGG - Intronic
1091231929 11:133993696-133993718 CCTCAGTTCCTCAGGCACATTGG - Intergenic
1091265370 11:134266764-134266786 CTTCTTTTCTTCAGAGACAAGGG - Intergenic
1091584239 12:1806822-1806844 CTTCTGTCCTTCAGCCACACTGG + Intronic
1091874350 12:3921214-3921236 CCTCTGAGCTTCTGGGACAAAGG - Intergenic
1092168342 12:6357011-6357033 CCTTTGTTCTTCAAGGCCAGTGG - Intronic
1092252273 12:6906202-6906224 TCTCTGTCCTTCACAGACACAGG + Intronic
1092399396 12:8161230-8161252 TCTATGTTCTTCAGGGATACAGG + Intronic
1093218767 12:16393621-16393643 CCTCTGATCTTGAGGGACATGGG + Intronic
1093267111 12:17016493-17016515 CCGTTGTTCTGCAGGCACACGGG - Intergenic
1093810040 12:23481159-23481181 TCTATGTTCATCAGGGATACTGG - Intergenic
1094453489 12:30606137-30606159 TCAATGTTCATCAGGGACACTGG - Intergenic
1095084739 12:38049087-38049109 GCTGTGTTTTTCAGGGACCCTGG - Intergenic
1095217129 12:39562877-39562899 CCTATGTTCATCAGGGATATTGG - Intronic
1095459797 12:42431111-42431133 ACTCTCATCTGCAGGGACACTGG - Intronic
1095648265 12:44576000-44576022 CCTCTGTGCTCCAGGCACATTGG + Intronic
1095827846 12:46549022-46549044 CCTCTGCTCTTGAGGAACCCAGG - Intergenic
1095908256 12:47399546-47399568 TCTATGTTCATCAGGGACATTGG - Intergenic
1096970599 12:55663242-55663264 CCTCTGGTTTTCAGTGACTCTGG + Intergenic
1097304154 12:58051121-58051143 TCTCTGTTCATCAGGGATATTGG - Intergenic
1097414899 12:59303099-59303121 TCAATGTTCTTCAGGGATACTGG - Intergenic
1097936331 12:65256335-65256357 TCTGTGTTCATCAGGGATACTGG + Intergenic
1099032353 12:77542637-77542659 TCTATGTTCATCAGGGATACTGG - Intergenic
1099242880 12:80159260-80159282 TCTATGTTCATCAGGGATACTGG + Intergenic
1099392126 12:82094558-82094580 TCTGTGTTCTTCAGGGATATTGG + Intergenic
1099400356 12:82195697-82195719 TCTGTGTTCATCAGGGATACTGG - Intergenic
1100025095 12:90118589-90118611 TCTCTGTTCATCAGGGATACTGG + Intergenic
1100172995 12:91998580-91998602 TCTCTGTTCATCAGGGATATTGG - Intronic
1103692985 12:122790916-122790938 GCTCTGTTCTCCAGGAACAGAGG + Intronic
1104310948 12:127653897-127653919 TCTCTGTTCTTCAGTGTCATGGG + Intergenic
1104941267 12:132396538-132396560 CCTCTGGTCATCAGTGGCACCGG - Intergenic
1105468228 13:20667451-20667473 CTGCTGCTCCTCAGGGACACTGG - Intronic
1106496301 13:30280062-30280084 CCTGTGTTCTGCAGGAACAGGGG + Exonic
1106604870 13:31219160-31219182 TCTATGTTCATCAGGGATACTGG - Intronic
1107230777 13:38107495-38107517 TCTATGTTCTTCAGGGATATTGG - Intergenic
1108692032 13:52867892-52867914 CCTCGGTTATTCTGGGAAACAGG + Intergenic
1109121994 13:58469377-58469399 TCTCTGTACTTCAGCCACACTGG - Intergenic
1110662618 13:78075167-78075189 TCGATGTTCATCAGGGACACTGG + Intergenic
1110689573 13:78416565-78416587 CAGCTGGTCTTCAGGGACAAAGG + Intergenic
1110745167 13:79044068-79044090 TTTCTGTTCTTCAGGAGCACAGG + Intergenic
1110901199 13:80827092-80827114 TCTATGTTCATCAGGGACATTGG + Intergenic
1110906117 13:80891936-80891958 ACTCTGTTCTTCAGCGACCCTGG + Intergenic
1111791076 13:92856073-92856095 TCTATGTTCATCAGGGATACTGG - Intronic
1112281717 13:98068690-98068712 ACCCTGTTCTTCAGGAACGCGGG + Intergenic
1112552026 13:100430345-100430367 ATGGTGTTCTTCAGGGACACTGG - Intronic
1113491535 13:110696083-110696105 CATGTCTTCTGCAGGGACACGGG - Intronic
1113643312 13:111973730-111973752 CCTGGGTTCTCCAGGGACCCCGG - Intergenic
1114147056 14:19989747-19989769 TCTGTGTTCATCAGGGACATTGG - Intergenic
1114867532 14:26615479-26615501 TCTGTGTTCTTCAGGGATATTGG - Intergenic
1116965451 14:51010268-51010290 GTTCTGTTATTGAGGGACACAGG + Intronic
1117737330 14:58780967-58780989 CCTCGGTTCTGAAGGGAAACTGG + Intergenic
1118077348 14:62314531-62314553 CGTCTGTTCTTCAGGATCATGGG - Intergenic
1118135781 14:63024949-63024971 TCTATGTTCTTCAGGGATATTGG - Intronic
1118139864 14:63068786-63068808 CCTATGTTCATCAGGGATATTGG + Intronic
1119851674 14:77870839-77870861 CCTCTCTTCTCCAGGGAGAAGGG + Intronic
1120181520 14:81347647-81347669 TCTATGTTCATCAGGGATACTGG - Intronic
1120487591 14:85133884-85133906 TCTATGTTCATCAGGGACATTGG - Intergenic
1120785350 14:88529395-88529417 TCTATGTTCATCAGGGATACTGG + Intronic
1121807858 14:96847682-96847704 CCTCTGTTCTTCATGCAAAAGGG + Intronic
1122349565 14:101079660-101079682 TCTATGTTTTTCAGGAACACTGG - Intergenic
1122402324 14:101474843-101474865 CCACTGTCTGTCAGGGACACGGG - Intergenic
1122608342 14:102963439-102963461 CCTCTGTTCTTCAGGGACACAGG + Intronic
1123982295 15:25615001-25615023 CCCTTGCTCCTCAGGGACACAGG - Intergenic
1124183614 15:27501303-27501325 TCTGTGCTCTTCAGGGACAAAGG - Intronic
1124704081 15:31946714-31946736 TCTCTGTTCATCAGGGATATTGG - Intergenic
1125115329 15:36084409-36084431 CAACTGTTCATCAGGGACACTGG - Intergenic
1125371262 15:38979988-38980010 TCTTTGTTCATCAGGGATACTGG + Intergenic
1126315647 15:47366378-47366400 TGTCTGTTCTTCAGGGACAAAGG + Intronic
1127101409 15:55569017-55569039 TCTATGTTCATCAGGGATACTGG + Intronic
1127343586 15:58070794-58070816 CCTCTACTTTTCAGGGACCCCGG + Intronic
1127461659 15:59204754-59204776 CTTCAGTACTTCAGGGACTCTGG + Intronic
1129191741 15:73941567-73941589 CCTCTGCTCTTGAGGGATTCAGG - Intronic
1130179927 15:81615382-81615404 ATTCTGTTCTTGAGGGACTCTGG + Intergenic
1130542010 15:84827139-84827161 CCTTTCATCTCCAGGGACACTGG - Intronic
1130739354 15:86581851-86581873 CCTCTCTTCATCAAGGACATGGG + Intronic
1130768776 15:86903001-86903023 CCTCTCTTCTTTTGGGACAATGG + Intronic
1132234695 15:100210521-100210543 TCTCAGGTCTTCAGGGCCACAGG + Intronic
1133752631 16:8736561-8736583 CAGCTGTGCTTCAGGGTCACTGG + Intronic
1133977727 16:10612046-10612068 CCTCTGCTCCTGAGGGAGACGGG - Intergenic
1134350197 16:13430412-13430434 CCTCTGGGCTTCAGGCCCACCGG - Intergenic
1135902148 16:26471114-26471136 CCTATGTTCATCAGGGATATTGG - Intergenic
1136132119 16:28229591-28229613 CCACAGTTGTTCAGGGACCCAGG + Intergenic
1137637495 16:49999592-49999614 CCTCTGTTCTGCAGGCTCACTGG - Intergenic
1138057422 16:53849778-53849800 CCTCTGTTCTTCCTGCTCACAGG - Intronic
1138369102 16:56510365-56510387 CCTCTCTTGTCCATGGACACTGG - Intronic
1139639833 16:68283275-68283297 CTTCAGTTCTTCAGGGAGCCAGG + Intronic
1139924743 16:70479881-70479903 CCTCTGTTCCTCCTGGACATAGG + Exonic
1140465712 16:75180337-75180359 TCTATGTTCATCAGGGATACTGG - Intergenic
1140699121 16:77565050-77565072 CCTCTGTGTTTCAGGGCCACTGG - Intergenic
1143609486 17:8009492-8009514 CCTCTTTGCTGCAGGGAGACAGG + Exonic
1144743577 17:17598172-17598194 CCTCTGTACTCCAGCCACACTGG + Intergenic
1146447833 17:32946915-32946937 GCTCTGCTCTTCAGTCACACTGG - Intergenic
1146794909 17:35774016-35774038 CCTCGCTTCCTCAGGGACTCTGG + Intronic
1147191716 17:38741832-38741854 CGGCTGTCCATCAGGGACACTGG - Intronic
1148671206 17:49411608-49411630 GCTCTGTTCTTCTGTGTCACAGG - Intronic
1149531079 17:57395790-57395812 CTTTTGTTCTTCAGTGTCACTGG + Intronic
1150093095 17:62347361-62347383 TCTATGTTCATCAGGGATACTGG + Intergenic
1150741895 17:67785819-67785841 CCTAGGTTTTCCAGGGACACTGG + Intergenic
1151069556 17:71193165-71193187 CCTCTGTGCTCCTGGGACCCTGG - Intergenic
1151110368 17:71669086-71669108 CCACAGTTGTTCAGGGACAGGGG + Intergenic
1151421838 17:74003670-74003692 TCTCTGCTCTTCATGGACATGGG - Intergenic
1152228952 17:79105236-79105258 CCTCCGTTCTGCAGGGACCCAGG + Intronic
1152293413 17:79453512-79453534 CCTCTGTTATCCTGGGACTCTGG - Intronic
1152760056 17:82103109-82103131 CGTCTGTGCTTTGGGGACACCGG + Intronic
1153711295 18:7802252-7802274 ACTCCTTTCTTTAGGGACACAGG - Intronic
1154061836 18:11069242-11069264 TCTGTGTTCATCAAGGACACTGG - Intronic
1155286769 18:24296927-24296949 CCTATGTTCATCAGGGATATTGG + Intronic
1156282478 18:35653578-35653600 CTCCTGGTCTTCAGTGACACAGG + Intronic
1156429147 18:37052062-37052084 CCTATGTTAATCAGGGATACTGG - Intronic
1156528991 18:37796859-37796881 CCTCTGTTTTCCATGGACAGAGG - Intergenic
1158055330 18:53272046-53272068 CCTCTGTGCTTCAGAGTGACTGG + Intronic
1158112254 18:53953395-53953417 CCTATGTTCATCAGGGATATTGG - Intergenic
1158545792 18:58395416-58395438 CCTCTGTGCTTCTGTGACATGGG - Intronic
1159138336 18:64362855-64362877 ACTATGTTCATCAGGGACATTGG - Intergenic
1160606271 18:80052170-80052192 CCTATGTTCATCAGGGACATTGG - Intronic
1161090645 19:2358337-2358359 CCTCTCTTCCTCAGGGCCATTGG - Intergenic
1162736066 19:12747768-12747790 CCCCTGCTCTCCAGGGTCACAGG - Intronic
1163003937 19:14385705-14385727 CCACGCTTCCTCAGGGACACAGG - Intronic
1163324917 19:16597143-16597165 TCTGGGTTCTTCTGGGACACGGG + Intronic
1164419225 19:28073770-28073792 TCTATGTTCATCAGGGATACTGG + Intergenic
1165440576 19:35824729-35824751 AGTCTGTTCTTCATGGAAACAGG + Intergenic
1165743307 19:38216363-38216385 CCTTTGTGCCTCAGGGACCCAGG + Exonic
1168340103 19:55617851-55617873 CCTTTGTTCTTCAGGACCCCAGG - Exonic
925529353 2:4842416-4842438 CACCTGTTCTTCAAGGACTCTGG + Intergenic
926064395 2:9825534-9825556 CCTCAATTCATCAGGGTCACGGG - Intergenic
926698302 2:15785624-15785646 CCTCTGCTGTTTAGGGACTCGGG + Intergenic
927204703 2:20599828-20599850 CATCTGTTCCCCAGGGAGACAGG + Intronic
927464056 2:23323974-23323996 CCCCTGGTCTCCAGGGACCCAGG + Intergenic
929015977 2:37495411-37495433 TCTATGTTCATCAGGGATACTGG + Intergenic
931535023 2:63265725-63265747 TCTGTGTTCATCAGGGACATTGG - Intronic
931610050 2:64089293-64089315 CCTATTTCCTTCAGGGAAACTGG + Intergenic
931714732 2:65020011-65020033 CCTCTGAGCTCCAGGGACAGGGG + Intronic
931914618 2:66940126-66940148 ACTATGTTCTTCAGTAACACTGG + Intergenic
932021145 2:68088131-68088153 CCTTTGTTATTCAAGGACTCTGG - Intronic
932215209 2:69961865-69961887 CATCTGTTATTCTGGAACACAGG - Exonic
933181544 2:79232466-79232488 CCTATGTTCATCAGGGATATTGG + Intronic
933337015 2:80971536-80971558 CCTATGTTCATCAGGGATATTGG - Intergenic
933405049 2:81847378-81847400 CTTCTGTTTTTCAGGATCACAGG - Intergenic
934056088 2:88252813-88252835 CTTCTGTTCTGCAGTAACACAGG - Intergenic
934764839 2:96874917-96874939 CATCTATTATTCAGGGGCACGGG - Intergenic
934912827 2:98274967-98274989 CCTCTGCTCCTCAGGGAGACAGG + Intronic
937828660 2:126396073-126396095 TCTATGTTCATCAGGGACATTGG + Intergenic
937967808 2:127527093-127527115 CCGCTGTTTTCCAGGAACACAGG - Intergenic
939744152 2:145948606-145948628 CCTATGTTCATCAGGGATATTGG + Intergenic
940579304 2:155557355-155557377 CCAATGTTCTTCAAGGATACTGG - Intergenic
940693720 2:156952964-156952986 CCTATGTTCATCAGGGATACTGG + Intergenic
940728689 2:157364447-157364469 CTTCTGTGCTTCAGCCACACTGG - Intergenic
940890845 2:159033852-159033874 GCTCTGTTCTTCAGGCACTGTGG + Intronic
941060958 2:160846443-160846465 TCTATGTTCATCAGGGACATTGG - Intergenic
941858074 2:170250683-170250705 ACCCAGTTCTTCCGGGACACTGG - Intronic
942741796 2:179189139-179189161 TCTCTGTTCATCAGGGATATTGG - Intronic
943131259 2:183855784-183855806 TCTATGTTCATCAGGGACATTGG - Intergenic
943478788 2:188392037-188392059 TCTATGTTCATCAGGGATACTGG + Intronic
944271127 2:197786009-197786031 TCTCTGCTCTTCAGAGACGCGGG + Exonic
944615031 2:201451519-201451541 CCTCGGTTCTGCGGCGACACCGG + Exonic
944836499 2:203585423-203585445 CCTCAGTTCTTCTGGAACAGAGG + Intergenic
946546601 2:220750771-220750793 CCTATGTTCATCAGGGATATTGG + Intergenic
946639032 2:221763348-221763370 TCTCAGTTCCTCAGGAACACTGG - Intergenic
947568587 2:231212818-231212840 CTTCTGTTCCTCCCGGACACAGG - Intronic
948074728 2:235156872-235156894 ACTCTGTTCTTCCTGGCCACAGG - Intergenic
948365554 2:237452348-237452370 GCTCTGTGCTGCAGGGACAGAGG + Intergenic
948872202 2:240807741-240807763 CCTATGTTCATCAGTGAAACTGG - Intronic
1169327958 20:4691689-4691711 CCTATGTTCATCAGGGATATTGG + Intronic
1169813791 20:9635354-9635376 CCTCTGTGCATGAAGGACACAGG - Intronic
1169993584 20:11530961-11530983 TCTATGTTCTTCAGGGATATTGG - Intergenic
1170241223 20:14168918-14168940 TCTATGTTCATCAGGGACATTGG - Intronic
1171081294 20:22187699-22187721 TCTATGTTCATCAGGGACATCGG + Intergenic
1173549134 20:43920412-43920434 GCTCCTTTCTTCAGGGGCACAGG + Intronic
1173562135 20:44013465-44013487 CCTCTGGTCTTCTGAAACACAGG + Intronic
1173973665 20:47171684-47171706 CCTCTGTCCATCCTGGACACTGG + Intronic
1174167563 20:48596038-48596060 CCTCTGAGCTTCTGGGTCACAGG - Intergenic
1175513200 20:59548894-59548916 CCTCTGTTCATCAGGGATATTGG - Intergenic
1176284093 20:64333979-64334001 TCTATGTTCATCAGGGACATTGG + Intergenic
1176350915 21:5795922-5795944 CATCTTTTCCCCAGGGACACTGG + Intergenic
1176357729 21:5916506-5916528 CATCTTTTCCCCAGGGACACTGG + Intergenic
1176525596 21:7865294-7865316 CCTATGTTCATCAGGGATATTGG + Intergenic
1176545236 21:8193992-8194014 CATCTTTTCCCCAGGGACACTGG + Intergenic
1176564187 21:8377037-8377059 CATCTTTTCCCCAGGGACACTGG + Intergenic
1176791629 21:13325709-13325731 CCACTGTCCTTCAGGGATAGGGG + Intergenic
1176910291 21:14557386-14557408 CCTCTCTCCTTCAGGGACAAAGG + Intronic
1176928177 21:14775414-14775436 CTTCTCTTCTTCAGGGAGTCTGG - Intergenic
1177990149 21:28027607-28027629 CCACTGTCCTTCAGGGATAGGGG - Intergenic
1178211985 21:30545361-30545383 CCTATATTCATCAGAGACACTGG + Intronic
1178244687 21:30939016-30939038 CTTCTGTTCTTTAGGGATAGGGG - Intergenic
1178659616 21:34495307-34495329 CCTATGTTCATCAGGGATATTGG + Intergenic
1178842714 21:36150764-36150786 CCTCTGCTCCTCAGGCACAGGGG - Intergenic
1179250886 21:39670335-39670357 CCACTGCCCTTCATGGACACGGG - Exonic
1179470520 21:41606991-41607013 CCTTTGTTCTTCCAGGACACAGG + Intergenic
1179570042 21:42273289-42273311 CCTTGGTTCTGCAGGGAGACGGG + Exonic
1180066544 21:45415377-45415399 CCTCTGGTCTTCAGGTCCCCAGG + Intronic
1180858356 22:19062365-19062387 CCTCTTTTCTCCAGGGAAGCCGG + Intronic
1180967632 22:19798836-19798858 CTCCTCTTCTTCAGGAACACAGG - Intronic
1182053809 22:27333953-27333975 CCACTGTACTTCAACGACACTGG - Intergenic
1182984468 22:34703260-34703282 CCTCGGGTCTGCAGGGACTCAGG - Intergenic
1183475109 22:38031796-38031818 CCACTGTTCTCCAGTGACCCAGG + Intronic
1184374565 22:44103506-44103528 GCTCTGTTTTTCAGGGAACCTGG + Intronic
1184650688 22:45918298-45918320 CCTCTGCCCTCCAGGGCCACAGG + Intergenic
1184766551 22:46575572-46575594 TCTCTGTCCTCCAGGGAAACAGG - Intergenic
1184874692 22:47266760-47266782 CCTCTGTTTTCCACTGACACTGG - Intergenic
1185053300 22:48564897-48564919 CCTCTTTTTTGCAGGGCCACTGG - Intronic
1185155774 22:49192573-49192595 TCCCTGTTGTTCAGGGAAACAGG + Intergenic
1203250106 22_KI270733v1_random:110230-110252 CATCTTTTCCCCAGGGACACTGG + Intergenic
950593962 3:13961971-13961993 TCTATGTTCATCAGGGACATTGG + Intronic
950744454 3:15075549-15075571 CCTCTGTGCTTGAGAGCCACAGG + Intronic
951309168 3:21102939-21102961 TCTATGTTCATCAGGGACATTGG + Intergenic
951404727 3:22281668-22281690 TCTATGTTCATCAGGAACACTGG + Intronic
952233041 3:31451955-31451977 CCTATGTTCATCAGGGATATTGG - Intergenic
952693209 3:36234462-36234484 TCTATGTTCATCAGGGACACTGG - Intergenic
953224599 3:41006058-41006080 TCTATGTTCATCAGGGACATTGG + Intergenic
953282288 3:41570844-41570866 CCTTTATTCTTCAGTGACTCTGG - Intronic
953335333 3:42089525-42089547 CCTCCGTGCTCCAGGTACACTGG + Intronic
953630545 3:44612416-44612438 CCTATGTTCATCAGGGATACTGG - Intronic
954421564 3:50421623-50421645 CCTTGGTACTACAGGGACACAGG + Intronic
956347590 3:68298149-68298171 CCTGTGTTCATCAGGGACTGAGG - Intronic
956806372 3:72817233-72817255 CTTCTCTCCTTCAGTGACACGGG + Exonic
957670580 3:83296068-83296090 TCTATGTTCATCAGGGATACTGG + Intergenic
958105797 3:89070899-89070921 CCAATGTTCATCAGGGACATTGG - Intergenic
958466530 3:94466578-94466600 ACTTTGTTCATCAGGGACTCTGG + Intergenic
958684970 3:97380480-97380502 CCTTTGGGCTTCAGGAACACAGG + Intronic
958876879 3:99626331-99626353 CATCTGTTCTTCATGTTCACTGG - Intergenic
959482581 3:106891391-106891413 TCTATGTTCATCAGGGATACTGG - Intergenic
960862874 3:122169218-122169240 CCAGTGGACTTCAGGGACACAGG - Intergenic
960918995 3:122727422-122727444 CCTCAGTCCTTCTGGGATACTGG - Intronic
961367707 3:126411313-126411335 TCTATGTTCATCAGGGAAACTGG + Intronic
961468135 3:127093709-127093731 GCTCTGTTCTTCATGGACCGAGG - Intergenic
961617967 3:128198616-128198638 CCTCTCTTTTGCAGAGACACTGG + Intronic
962532403 3:136295282-136295304 CATCTCTACTTTAGGGACACTGG - Intronic
962680260 3:137792018-137792040 CTTCTGTTCTGCAGGTACACAGG + Intergenic
962835087 3:139182855-139182877 CCTCTGTTCTTCAGGAGAGCAGG - Intronic
962911231 3:139852283-139852305 CCTATGTTCTTCAGAGATATTGG + Intergenic
963113190 3:141703063-141703085 CCTATGTTCATCAGGGATATTGG - Intergenic
964458288 3:156893039-156893061 TCTCTGTTCTTGAGGGGCTCTGG + Intronic
965038421 3:163472534-163472556 TCTATGTTCTTCAGGGATATTGG + Intergenic
965090752 3:164159884-164159906 TCTGTGTTCATCAGGGACATTGG + Intergenic
965467351 3:169046692-169046714 ACTCTGCTCTTCAGGCAGACAGG - Intergenic
965792188 3:172401537-172401559 CCTCTGTTCACCTGGCACACTGG + Exonic
966518046 3:180841537-180841559 TCTATATTCTTCAGGGATACTGG + Intronic
966530785 3:180976834-180976856 ACTCTCATCTGCAGGGACACTGG + Exonic
967239242 3:187420594-187420616 CCTATGTTCATCAGGGATATGGG - Intergenic
967784665 3:193478832-193478854 TCTATGTTCATCAGGGACATTGG - Intronic
968138107 3:196233762-196233784 CATCTGTTCTCCAGGGCCCCTGG - Intronic
968423135 4:502038-502060 CCCCTGATTTTCAGGAACACCGG + Intronic
969417988 4:7073594-7073616 CCTCAGGTCATCAGGGACCCAGG + Intergenic
970648570 4:18151830-18151852 TCTATGTTCATCAGGGACATTGG - Intergenic
971062026 4:22982826-22982848 TCTCTGTTCATCAGGGATATTGG - Intergenic
971481249 4:27116904-27116926 TTACTGTTCTTCAGGGACACTGG - Intergenic
974239695 4:59230587-59230609 CCTATGTTCATCAGGGATATTGG - Intergenic
974681747 4:65173586-65173608 CCTCTGTGATACAAGGACACTGG + Intergenic
974899369 4:67978467-67978489 CCTATGTTCATCAGGGATATTGG + Intergenic
975198024 4:71549131-71549153 CTTATGTTCTGCAGGGACAGAGG + Intronic
975226368 4:71877060-71877082 CCTATGTTCATCAGGGATATTGG + Intergenic
976454761 4:85233658-85233680 CCTCTGATTTTCACGGACAGAGG - Intergenic
976856089 4:89607249-89607271 CCTCTCTTCTTGGGGGAAACTGG + Intergenic
976869882 4:89778506-89778528 TCTCTGTTCATCAGGGATATTGG - Intronic
977009327 4:91616302-91616324 TCTATGTTCATCAGGGACATTGG - Intergenic
977387982 4:96369032-96369054 TCTATGTTCATCAGGGACATTGG + Intergenic
977967643 4:103172170-103172192 TGTCTGTTCTTCAGGGATATTGG - Intronic
978339272 4:107705085-107705107 TCTATGTTCATCAGGGACACTGG + Intronic
978888444 4:113794590-113794612 TCTATGTTCTTCAGTGATACTGG - Intergenic
978910351 4:114055418-114055440 TCTATGTTCATCAGGGATACTGG + Intergenic
980644814 4:135629800-135629822 TCTATGTTCTTCAGGGATATTGG + Intergenic
980737601 4:136911512-136911534 ACTCTGTTCTTCATTGAAACAGG + Intergenic
981004959 4:139865443-139865465 GCTCTGTAATTCAGGGACAAGGG - Intronic
981484109 4:145267129-145267151 GCTCTGTTCTTCAGGGCATCTGG + Intergenic
982821614 4:159947124-159947146 CCTCTGTTTTTAAGACACACAGG - Intergenic
982992079 4:162289407-162289429 TCTATGTTCATCAGGGATACTGG - Intergenic
983111738 4:163758584-163758606 CTTCTGTCCTTCAGGGAAATTGG - Intronic
983845312 4:172510871-172510893 TCTATGTTCTTCAGGGATATTGG + Intronic
984188292 4:176573285-176573307 CCTCTTTGCTTCAGTGAGACAGG - Intergenic
985393380 4:189514958-189514980 CCTTTGTCCCTCAGGGACACAGG - Intergenic
986634333 5:9805461-9805483 TCTATGTTCTTCAGGGATATGGG - Intergenic
987444404 5:18000153-18000175 CCTATGTTCATCAGTGATACTGG + Intergenic
987648974 5:20715819-20715841 GCTATGTTCATCAGGGATACTGG + Intergenic
988091714 5:26550311-26550333 TCTATGTTCATCAGGGACATTGG - Intergenic
988193966 5:27976916-27976938 CCTGTGTTCTTCAGGAATATTGG + Intergenic
988746594 5:34145718-34145740 GCTATGTTCATCAGGGATACTGG - Intergenic
989005516 5:36807006-36807028 CCTATGTTCCTGAGGGATACTGG + Intergenic
990365794 5:55069147-55069169 CCTCTTTTCCTCATGGCCACTGG - Intergenic
990655054 5:57945779-57945801 CCTATGTTCATCAGGGATATTGG + Intergenic
990894450 5:60683005-60683027 TCTATGTTCATCAGGGACATTGG - Intronic
991970964 5:72141239-72141261 CCTTTGCTCTGCAGAGACACTGG + Intronic
992468113 5:77027453-77027475 CCACAGTTCTTCAGGGACCCAGG - Intergenic
992599559 5:78384878-78384900 TCTCTGTTCATCAGGGATATTGG + Intronic
993614059 5:90088512-90088534 TCTCTGTTCATCAGGGATATTGG - Intergenic
993750074 5:91654673-91654695 CCTATGTTCATCAGGAACATTGG - Intergenic
995455868 5:112351708-112351730 CCTATGTTCATCAGGGATATAGG - Intronic
996521481 5:124431304-124431326 TCTGTGTTCATCAGGGATACTGG - Intergenic
997006656 5:129824863-129824885 TCTATGTTCATCAGGGATACCGG - Intergenic
997061962 5:130516867-130516889 TCTATGTTCATCAGGGACACTGG + Intergenic
998485584 5:142499075-142499097 TCTCTTTTCTTAAAGGACACAGG + Intergenic
998703092 5:144727724-144727746 CCTATGTTCATCAGGGATACTGG + Intergenic
998733639 5:145109731-145109753 CCTCTTTTCTTCAGAGAAAGTGG - Intergenic
999067356 5:148703566-148703588 TCTGTGTTCATCAGGGACATTGG + Intergenic
999255628 5:150208686-150208708 CCTCCTTTCTTTAAGGACACAGG + Intronic
999591067 5:153147014-153147036 CATCTGTTTATCAGGGACATTGG - Intergenic
999888038 5:155945700-155945722 CTTCTGGGCTTCAGGAACACTGG - Intronic
1002582768 5:180220002-180220024 TCTATGTTCGTCAGGGACATTGG + Intergenic
1002604707 5:180375731-180375753 CCTCTGTTGTCCAGAGACTCAGG + Intergenic
1003001599 6:2340345-2340367 CCTATGTTCATCAGGGATATTGG - Intergenic
1003746190 6:9005159-9005181 GTGCTGTTCTTCAGAGACACAGG - Intergenic
1003942073 6:11039309-11039331 CCTCTGTTCACCAGGCACACAGG + Intronic
1005544739 6:26853957-26853979 GCTATGTTCATCAGGGATACTGG - Intergenic
1006136281 6:31897868-31897890 CCTCAGTTCTGCAGGGACCGAGG + Intronic
1006253472 6:32810724-32810746 ACTCTGGTTTTCAAGGACACAGG - Intergenic
1006280066 6:33044929-33044951 CCTATGTTCATCAGGGATATTGG + Intergenic
1007151237 6:39693882-39693904 TCTATGTTCTTCAGGGATATTGG - Intronic
1008690955 6:53977903-53977925 CCAGTTTTCTTCATGGACACAGG + Intronic
1008781517 6:55111857-55111879 TCTATGTTCATCAGGGACATTGG - Intronic
1009015529 6:57895590-57895612 GCTATGTTCATCAGGGATACTGG - Intergenic
1010399766 6:75435113-75435135 TCTCTGTTCATCAGGGATATTGG + Intronic
1010503146 6:76625566-76625588 TCTCTGTTCATCAGGGATATTGG + Intergenic
1012183413 6:96183870-96183892 TCTATGTTCTTCAGGGATATCGG + Intronic
1012691480 6:102318757-102318779 CTTTTGTTCTTCTGGGACCCTGG + Intergenic
1013292291 6:108729812-108729834 CCTCTGTGCTTTCAGGACACTGG - Intergenic
1014088809 6:117379058-117379080 CAGCTGTTCTTCGGGGACAGAGG - Exonic
1014481760 6:121947713-121947735 TCTATGTTCATCAGGGATACTGG + Intergenic
1014833880 6:126135700-126135722 TCTGTGTTCATCAGGGATACTGG - Intergenic
1018496750 6:164355322-164355344 TCTATGTTCATCAGGGACATTGG + Intergenic
1020150866 7:5680781-5680803 GCTGTGTCCTTCAGGGATACAGG - Intronic
1020584629 7:10051035-10051057 TCACTGTTCATCAGGGATACTGG - Intergenic
1020780588 7:12512614-12512636 CCTCTGTTCATCAGGAATATTGG + Intergenic
1021042259 7:15876847-15876869 TTTCTGTTCCTCAGGGGCACTGG - Intergenic
1021753627 7:23829554-23829576 TCTGTGTTCATCAGGGATACTGG + Intronic
1022186669 7:27976031-27976053 CATATATTCTTGAGGGACACTGG - Intronic
1022762627 7:33372580-33372602 TCTTTGTTCATCAGGGATACTGG + Intronic
1022968665 7:35497461-35497483 CCTCTGCTCTTATGGAACACTGG - Intergenic
1023657841 7:42443756-42443778 TCTATGTTTTTCAAGGACACTGG + Intergenic
1023866458 7:44240679-44240701 CCTTTCTTCTCCAGGGAGACAGG - Intronic
1023964593 7:44956448-44956470 CATCTGTTCTTCAGGAGCTCCGG + Intergenic
1025018231 7:55459300-55459322 CCTGTGTTCATCAGGGATATTGG + Intronic
1028644792 7:93083503-93083525 TCTGTGTTCATCAGGGATACCGG - Intergenic
1028949402 7:96617954-96617976 CCTGTGTTCATCAGGGATATTGG + Intronic
1029007992 7:97230398-97230420 ACCCTATTCTTCTGGGACACTGG + Intergenic
1029098974 7:98112489-98112511 CTTCAGTTCTTCAGTGGCACTGG + Intronic
1031465725 7:122108387-122108409 TCTATGTTCTTCAGGGATATTGG - Intronic
1032119958 7:129148532-129148554 CCTCCCTTCCTCATGGACACTGG + Intronic
1032891152 7:136196828-136196850 TCTATGTTCATCAGGGATACTGG + Intergenic
1033276037 7:139972155-139972177 CCTCTGCTCTGCAGGGACTCAGG - Intronic
1033431852 7:141296383-141296405 CCACTGGTCTTCAGGGGCAAGGG + Intronic
1034708208 7:153166279-153166301 TCTATGTTCATCAGGGATACTGG - Intergenic
1035361293 7:158315518-158315540 CCTCTGTCCTTCAGGGGTCCCGG - Intronic
1035361301 7:158315546-158315568 CCTCTGTTCTTCAGGGGTCCCGG - Intronic
1035416057 7:158687670-158687692 CCTCTGTCCTCAAGGGCCACAGG + Intronic
1035759673 8:2060607-2060629 CCTCTGTTCTTCAGAGGAAAAGG + Intronic
1035835443 8:2746379-2746401 CCTGTGTTCATCAGGGATATTGG - Intergenic
1036943377 8:13071862-13071884 CCTCTCTTTTTCTGGGCCACTGG + Intergenic
1037576475 8:20209310-20209332 CCTCTACTCTTCACAGACACAGG - Intronic
1037709310 8:21342902-21342924 CCTGTGTTGTGCAGGGCCACAGG - Intergenic
1038260056 8:25985022-25985044 ACTCTGCTCTTAAGGGAGACAGG + Intronic
1039756697 8:40531011-40531033 CCTATGGTCGTTAGGGACACAGG + Exonic
1039837714 8:41269965-41269987 CCTGTGGTCTTCATTGACACTGG - Intronic
1039926212 8:41934368-41934390 CCTCTGCTCCTCTGAGACACGGG + Exonic
1040626459 8:49155251-49155273 TCTATGTTCTTCAGGGATATTGG + Intergenic
1040790268 8:51220503-51220525 TCTCTGTTCCTCAGGGATATCGG - Intergenic
1040822665 8:51581645-51581667 CCTGTGTTCATCAGGGATACTGG + Intronic
1041363922 8:57081739-57081761 TCTATGTTCATCAGGGATACTGG + Intergenic
1041560391 8:59211279-59211301 CCTATGTTCATCAGGGATATTGG + Intergenic
1042873135 8:73416034-73416056 CCTCATTTCCTCAGGCACACAGG - Intergenic
1043047788 8:75349628-75349650 TCTATGTTCATCAGGGATACTGG - Intergenic
1043144293 8:76632533-76632555 TCTATGTTCATCATGGACACTGG + Intergenic
1043783015 8:84360861-84360883 ACTGTGTTCTTCAGGGAGTCAGG + Intronic
1044078613 8:87856070-87856092 CCTCTGTTCTTGGGGAAAACAGG - Intergenic
1044188924 8:89290537-89290559 TCTATGTTCTTCAGGGATATTGG - Intergenic
1045854481 8:106748458-106748480 ACTCTCTTCTTGAGTGACACTGG + Intronic
1046066780 8:109206900-109206922 TCTCTCTTCTTCTGGGACCCCGG + Intergenic
1046308153 8:112398177-112398199 GCTCTGTTCTTCAGTCCCACTGG + Intronic
1047596187 8:126380035-126380057 CTTCTGTTCTCCAGGGACATAGG - Intergenic
1048020158 8:130530925-130530947 CTCATGTTCTTCAGTGACACAGG + Intergenic
1048950699 8:139494373-139494395 CATCTGTTTCTAAGGGACACTGG - Intergenic
1048977103 8:139679239-139679261 CACCTGTGCGTCAGGGACACAGG - Intronic
1050428850 9:5540927-5540949 TCTATGTTCATCAGGGATACTGG - Intronic
1051685398 9:19653137-19653159 CCTCTGTCCTCAAGGGAAACAGG - Intronic
1051703687 9:19853736-19853758 CCGATGTTCATCAGGGATACTGG + Intergenic
1051843340 9:21423572-21423594 CCTATGTTGTTCAGGGATATTGG + Intronic
1051920912 9:22262824-22262846 CATCTGTTCATCAGGGATATTGG + Intergenic
1052519128 9:29521535-29521557 TCTCTGTTCTTCAGCCATACTGG + Intergenic
1055186856 9:73467407-73467429 CCTGTGTTCATCAGAGATACTGG + Intergenic
1055803954 9:80072218-80072240 CCTCTGTGTGTCAGGGAGACTGG + Intergenic
1056091399 9:83208996-83209018 CTTCTGTGCCTCAGGGACAAAGG + Intergenic
1056204470 9:84306664-84306686 CATCTGTTCTCCAGGGTCTCTGG - Intronic
1056335488 9:85564225-85564247 TCTCTGCTCTTCAGGCCCACTGG - Intronic
1056415616 9:86373014-86373036 TCTGTGTTCATCAGAGACACTGG + Intergenic
1056758614 9:89398630-89398652 TCTCTGTTCTCCATGGACAGTGG - Intronic
1058565537 9:106280781-106280803 TCTATGTTCTTCAGGGATATTGG + Intergenic
1058716970 9:107731074-107731096 ACACAGTTCTTCAGGGAAACTGG - Intergenic
1058784286 9:108371179-108371201 TCTATGTTCATCAGGGATACTGG + Intergenic
1059656512 9:116362578-116362600 TCTCTGTTGTTCAGGGACTTGGG + Exonic
1059820782 9:117969810-117969832 CCTCTCCACTTCAGGCACACTGG + Intergenic
1060079860 9:120633017-120633039 CCTATGTTATTCAGGGATATGGG + Intronic
1061279516 9:129589273-129589295 CCACTGTTTTTCAGCCACACAGG - Intergenic
1061506937 9:131036800-131036822 CATGTCTTCTCCAGGGACACAGG + Intronic
1062021950 9:134323932-134323954 CCTCTGTTCCTAAGAAACACCGG - Intronic
1062366108 9:136209798-136209820 CCACTGCACTTCAGGTACACTGG + Intronic
1203466507 Un_GL000220v1:93497-93519 CATCTTTTCCCCAGGGACACTGG + Intergenic
1185521247 X:741418-741440 CCTCGGTTCTTCTGGGTCTCAGG + Intergenic
1185745731 X:2572058-2572080 CCCATGATCTCCAGGGACACCGG + Intergenic
1186600507 X:11031692-11031714 CCTATGTTCATCAGGGATATTGG - Intergenic
1187250444 X:17593417-17593439 CCTTTGGTCTTCAGGAAAACAGG + Intronic
1187498641 X:19818846-19818868 TCTATGTTCTTGAGGGACACTGG + Intronic
1187983772 X:24787924-24787946 TCTGTGTTCATCAGGGATACTGG - Intronic
1188934164 X:36153342-36153364 ACTCTGTTCTCCAGGCCCACTGG + Intergenic
1189667395 X:43371436-43371458 CATCTGTTTTCCAGGGACTCAGG - Intergenic
1189724414 X:43954224-43954246 CCGCTCATCTTCAGGGACCCAGG + Intronic
1190716715 X:53110544-53110566 TCTCTGTTCATCAGGGATATTGG + Intergenic
1190926789 X:54916541-54916563 TCTATGTTCCTCAGGGATACTGG + Intergenic
1190967629 X:55316305-55316327 CCTGTGTTCATCAGGGATATTGG + Intergenic
1191017263 X:55822439-55822461 TCTGTGTTCATCAGGGATACTGG + Intergenic
1191913443 X:66176457-66176479 CCTATGTTCATCAGGGATATCGG + Intronic
1192015800 X:67329141-67329163 TCTATGTTCATCAGGGACACTGG + Intergenic
1192113925 X:68392933-68392955 ACTCGATTCTTCCGGGACACTGG + Intronic
1192637469 X:72832783-72832805 CCTGTGTTCATCAGGGACACTGG - Intronic
1192644245 X:72888031-72888053 CCTGTGTTCATCAGGGACACTGG + Intronic
1192953389 X:76041699-76041721 TCTTTGTTCATCAGGGACAGTGG + Intergenic
1193405251 X:81092902-81092924 TCTATGTTCATCAGGGATACTGG - Intergenic
1193706894 X:84832185-84832207 CCTCTGTTCCTAAGGGGCTCAGG - Intergenic
1194103472 X:89737451-89737473 CCTTTCTTCTTTAGGAACACTGG + Intergenic
1194381380 X:93195851-93195873 TCTATGTTCTTCAGGGATATTGG - Intergenic
1195812207 X:108846727-108846749 TCTATGTTCATCAGGGATACTGG - Intergenic
1195905492 X:109840357-109840379 CCCCCGTCCTCCAGGGACACAGG - Intergenic
1196557272 X:117102856-117102878 TGTGTGTTCATCAGGGACACTGG - Intergenic
1198138025 X:133773863-133773885 TCTCTGGCCTTCAGGGAGACAGG + Intronic
1198184137 X:134237385-134237407 CCCCTCTTCTTCCCGGACACAGG + Intronic
1198333266 X:135641981-135642003 CATCTGCTCTTCATGGACATTGG + Intergenic
1200031338 X:153298362-153298384 CCTCTGTTCATCAGAGATATTGG - Intergenic
1200113133 X:153753907-153753929 CCTGTGTTCATCAGGGATATTGG - Intergenic
1200365640 X:155659468-155659490 CCTATGTTCATCAGGGATATTGG + Intronic
1201349271 Y:13021775-13021797 CCTATGTTCTTCAGGGATATTGG + Intergenic
1201491521 Y:14547088-14547110 TTTCTGTTCTTCAGGGATTCAGG + Intronic
1201621359 Y:15962299-15962321 CCTCTGCTCTTCTGGGTCTCAGG + Intergenic