ID: 1122608746

View in Genome Browser
Species Human (GRCh38)
Location 14:102966452-102966474
Sequence GGGGACGTTCCCGCCTTCCT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 68}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122608746 Original CRISPR GGGGACGTTCCCGCCTTCCT CGG Intronic
900585047 1:3428623-3428645 GGGAACGTTCCCGCCACCCCAGG - Intronic
901063802 1:6485583-6485605 AGGGAGGTGTCCGCCTTCCTGGG - Intronic
901537630 1:9892860-9892882 GGGGAGGTTTCCTCCTTCCTTGG - Intronic
903834937 1:26197681-26197703 GAGGATGTTCCAGCCGTCCTGGG - Exonic
905971513 1:42145559-42145581 GGGGAAGTTCCATGCTTCCTGGG + Intergenic
914349202 1:146825759-146825781 GGGCCCGTTCCCCCATTCCTGGG + Intergenic
920174602 1:204092688-204092710 GGGGACAGTCCAGCATTCCTGGG + Intronic
920208634 1:204312348-204312370 GGGGGTGTTCAGGCCTTCCTGGG + Intronic
920708854 1:208275865-208275887 TGGGACGTTCCCTCTTCCCTTGG + Intergenic
1062835941 10:635694-635716 GGGCAATTTCCCGCCTTCCCCGG - Intronic
1074875684 10:117611438-117611460 GGGGACTGTCCCGCCCTCCTGGG + Intergenic
1075846529 10:125549389-125549411 CGGGAAGTTGCCTCCTTCCTAGG - Intergenic
1077095145 11:795992-796014 GGGGCCTTTCCCCCCTCCCTGGG + Intronic
1078531245 11:12138536-12138558 TGGGATGTTCCCACCATCCTGGG + Intronic
1081276009 11:41149617-41149639 AGGGACCTACCTGCCTTCCTGGG + Intronic
1084117990 11:67052984-67053006 GGGGACGTGCCCTCCTGCCCTGG - Intergenic
1090424261 11:126596034-126596056 GGAGACTTTCCTGCCTTCCTAGG - Intronic
1117337604 14:54767976-54767998 GGGAATGTTGGCGCCTTCCTGGG - Intronic
1122608746 14:102966452-102966474 GGGGACGTTCCCGCCTTCCTCGG + Intronic
1124019098 15:25903487-25903509 GGGGCCGGCCCCTCCTTCCTGGG - Intergenic
1128419846 15:67481368-67481390 GGGGATGTTCCCCCTTTGCTCGG - Intronic
1132099840 15:99015308-99015330 GGGGAAGTCCCTGCCTTCCCAGG + Intergenic
1132106804 15:99068713-99068735 GGGGAGACTCCTGCCTTCCTGGG + Intergenic
1132649103 16:1012544-1012566 GGGGTAATTCCTGCCTTCCTGGG - Intergenic
1134596165 16:15497773-15497795 GGGGATTATCCCGCCATCCTAGG - Intronic
1142608881 17:1096961-1096983 GGGCAGGTTCCCCCCTTCCCCGG - Intronic
1143393031 17:6571356-6571378 GAGGACATGCCCGCCTTGCTGGG + Intergenic
1143595669 17:7912231-7912253 GGGAATGTTCCCCCCTCCCTAGG + Exonic
1147179416 17:38674830-38674852 GGGGTCCTTCCCGCCTCCCGCGG - Exonic
1147188652 17:38726254-38726276 GGGGAGGCTCTGGCCTTCCTTGG + Exonic
1147741599 17:42673608-42673630 GGGGACTCTCCTACCTTCCTAGG - Intronic
1150250801 17:63703507-63703529 GGCCACATTCCCGCCCTCCTGGG - Exonic
1150448727 17:65247877-65247899 GGGGATGTTCCTTCCTTCCCAGG + Intergenic
1152242310 17:79167045-79167067 GGTGACGTGCCCGCCTTGCCGGG - Intronic
1153768023 18:8393222-8393244 GGGGATGTTCCCTCCTCCCAGGG - Intronic
1154124050 18:11673874-11673896 GGTGACGTGCCCTGCTTCCTGGG - Intergenic
1155538775 18:26844927-26844949 GGGGCTGTTCCCTCATTCCTTGG + Intergenic
1158538382 18:58329102-58329124 GGGGACATCCCCGCCCTCCGAGG - Exonic
1160686400 19:438895-438917 GGGGACGCTGCGGCCATCCTGGG - Intronic
1160897866 19:1411174-1411196 GGGGCCGTGCCGGCCTTTCTGGG + Intronic
1161533408 19:4803989-4804011 GGGGACGGTCCCTCTTTCCCGGG - Intergenic
1166831537 19:45642407-45642429 GGGGTCCCTCCCGCCTTCCTGGG + Exonic
1167203908 19:48086976-48086998 GGGGACATTACCGGATTCCTTGG + Intronic
930174586 2:48288725-48288747 GGGGACTTTCCCCCTTTGCTCGG + Intergenic
941935150 2:170975993-170976015 GGGGAGGGGCCTGCCTTCCTGGG + Intergenic
1174419043 20:50387518-50387540 GGTGAAGTTCCTGCTTTCCTGGG - Intergenic
1181592550 22:23894287-23894309 GGGGAAGTCACCGCCTGCCTCGG - Exonic
1181898077 22:26128881-26128903 GGAGACATTCCAGCCCTCCTGGG + Intergenic
1183066744 22:35368622-35368644 AGGGTCCTTCCTGCCTTCCTTGG + Intergenic
1185020283 22:48370504-48370526 GAGGACGTTCCCTCCTTGCAGGG + Intergenic
1185062710 22:48615474-48615496 GGGGCCATGCTCGCCTTCCTGGG + Intronic
954907780 3:54077401-54077423 GGGGAGGTTCCCAGCTGCCTAGG - Intergenic
955404686 3:58618679-58618701 GGGCACCTTCCCCCCATCCTCGG - Intronic
967942033 3:194773501-194773523 GTGGATGTTCTCTCCTTCCTTGG - Intergenic
968360999 3:198146746-198146768 TGGGAAGATCCCGCCCTCCTTGG - Intergenic
985991735 5:3567444-3567466 GGGGAGGTTCCCTCCATCCCAGG - Intergenic
1002326821 5:178415267-178415289 GGGGACGAGCCCGCCTTGCTGGG + Intronic
1005570510 6:27140757-27140779 GGAGATTTTCCCGCTTTCCTCGG + Intergenic
1010569853 6:77463576-77463598 GGGGAGGCGCCCGCCTGCCTTGG - Intergenic
1014674715 6:124349297-124349319 CGGGAAGTTCCCGCCTTTGTAGG - Intronic
1019259011 7:69908-69930 TGGGAAGATCCCGCCCTCCTTGG + Intergenic
1025251972 7:57357483-57357505 GGTGAAGTTCCCGCTTTCGTAGG + Intergenic
1036295900 8:7537040-7537062 AGGGAAGTTCCCTTCTTCCTTGG - Intergenic
1036326666 8:7783979-7784001 AGGGAAGTTCCCTTCTTCCTTGG + Intergenic
1042317000 8:67435513-67435535 GGGGAGGCTCCGGCCTTCCTTGG + Intronic
1043954340 8:86343064-86343086 GGGGACGGTCCGCCCTACCTTGG + Intronic
1045717188 8:105061548-105061570 GCTGATGTTCCCTCCTTCCTTGG + Intronic
1049651322 8:143771259-143771281 GGGGAGGTTCCCGCAGACCTGGG + Intergenic
1049830870 8:144700109-144700131 TGGAACGTTCGCGCCTTCGTAGG - Intergenic
1052812833 9:33076546-33076568 GGGGATGTTCGCGCCTTGCCGGG - Intronic
1052847046 9:33346092-33346114 TGGAATGTTCCCTCCTTCCTTGG + Intronic
1053415076 9:37942333-37942355 TGGGACCTTCCTGCCATCCTTGG + Intronic
1056274001 9:84975058-84975080 GGGGAGGGTGCCGCCTTCCAAGG - Intronic
1059526899 9:115000399-115000421 GGGGAATTTCCCGTCCTCCTTGG + Intergenic
1062745707 9:138210573-138210595 TGGGAAGATCCCGCCCTCCTTGG - Intergenic