ID: 1122609275

View in Genome Browser
Species Human (GRCh38)
Location 14:102970113-102970135
Sequence GGTCTCTGCCCTTAACTGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 109}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122609275_1122609278 -1 Left 1122609275 14:102970113-102970135 CCTCTCAGTTAAGGGCAGAGACC 0: 1
1: 0
2: 0
3: 11
4: 109
Right 1122609278 14:102970135-102970157 CCCCGCCCAGCACTACCTTGAGG 0: 1
1: 0
2: 2
3: 6
4: 126
1122609275_1122609280 0 Left 1122609275 14:102970113-102970135 CCTCTCAGTTAAGGGCAGAGACC 0: 1
1: 0
2: 0
3: 11
4: 109
Right 1122609280 14:102970136-102970158 CCCGCCCAGCACTACCTTGAGGG 0: 1
1: 0
2: 0
3: 6
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122609275 Original CRISPR GGTCTCTGCCCTTAACTGAG AGG (reversed) Intronic
900726558 1:4220066-4220088 GGACTCTGCCCTTTACTGGCAGG + Intergenic
900791275 1:4682540-4682562 GGTTTCTGCTCTTTCCTGAGTGG + Intronic
901316824 1:8315274-8315296 GCTCTCTGCCCTGAACTTGGAGG + Intergenic
901798513 1:11693858-11693880 GGTCTCTGTAGTTAACTGAGTGG - Intronic
902189440 1:14751639-14751661 GGTCTTTGCTCTTAACTGCTGGG + Intronic
902799361 1:18819757-18819779 GGCCTCTGCCCTTAGCTGTGGGG - Intergenic
903320137 1:22538274-22538296 AGTCTCTGTCCTCAACTGGGAGG + Intergenic
905961896 1:42050036-42050058 GTTCTCTGCCCTTCTCTGCGTGG + Intergenic
908963229 1:69727170-69727192 GGGCCCTGCCCTTGACTGAAGGG - Intronic
912375083 1:109203363-109203385 TGTTTCTGCCCTTAAGTTAGAGG - Intronic
912803584 1:112737704-112737726 GGTCTCTGCCCTTGGCAGATTGG - Intergenic
914336160 1:146716694-146716716 GTTCTCTGCCCCTAATGGAGTGG + Intergenic
1063343196 10:5287863-5287885 GTTCTCTGCCATGAACTGAGTGG + Intergenic
1065929019 10:30462824-30462846 TGCCTCTGCCCTTACCAGAGGGG - Intergenic
1069340396 10:67402796-67402818 GGTCTCTGTGCATACCTGAGTGG - Intronic
1069452812 10:68530782-68530804 AGTCTCTGCCCTAAACTCTGAGG + Intergenic
1072754665 10:98011281-98011303 GGTTTCTGCCCATCACTGAGGGG - Exonic
1076024213 10:127099296-127099318 AGTCTCTGTCCTTACCTGTGAGG + Intronic
1079790218 11:24728201-24728223 GGACACAGCCCTTCACTGAGAGG - Intronic
1086261484 11:84946093-84946115 GGATACTGCCCTTAACGGAGAGG - Intronic
1086500901 11:87452600-87452622 GGGCTCTGCCCTGAACTCAATGG + Intergenic
1087115942 11:94524531-94524553 GTTCTTTGCCCTTATCTGATAGG - Intergenic
1098907096 12:76173254-76173276 GGTCTCTGCCCCTAAGGAAGGGG - Intergenic
1100408329 12:94290560-94290582 GGCCTCTGGCCTAAACTTAGCGG + Intronic
1100674013 12:96846960-96846982 GGACTGAGCCCTTAACTGTGGGG - Intronic
1103391358 12:120575943-120575965 AGCCTCTGCCCTTACCAGAGAGG - Exonic
1103607880 12:122100778-122100800 GGTCTGTGCACTTGACTCAGAGG - Intronic
1107886638 13:44879158-44879180 GGTCTCTGCCCTGAGCCGGGAGG + Intergenic
1108501168 13:51071339-51071361 GGTCTCTGGCCTGCACTGGGTGG - Intergenic
1110471337 13:75863461-75863483 TGTATCTGCCCTTAAATGTGTGG - Intergenic
1111522993 13:89428846-89428868 GGTCTGTGCCACTAACAGAGAGG - Intergenic
1113130297 13:107029113-107029135 GTTCTCTGCCTGGAACTGAGCGG - Intergenic
1120712149 14:87804240-87804262 GGTCTCCTCCCTTAACTGCAAGG - Intergenic
1121360042 14:93248559-93248581 GGCCTATGCCCTGAACTGCGGGG - Exonic
1121435420 14:93916034-93916056 ATTCTCTTCCCTTAGCTGAGTGG - Intergenic
1122155998 14:99750816-99750838 GGTCGAAGCCCTGAACTGAGGGG - Intronic
1122609275 14:102970113-102970135 GGTCTCTGCCCTTAACTGAGAGG - Intronic
1125370373 15:38969624-38969646 GGTCTCTACACTTAACTGGTTGG + Intergenic
1127287118 15:57541902-57541924 GGCCTCTGCCCCTAGGTGAGGGG - Intronic
1129217228 15:74107338-74107360 GGTCACAGCCCATGACTGAGGGG - Intronic
1132469060 16:91859-91881 AGTCTCTGCCCAGAACTCAGTGG + Intronic
1136099977 16:27986853-27986875 GGGCTCCGCCCTGAACTCAGTGG + Intronic
1138747322 16:59378346-59378368 GGAGTCTGGCCTTAGCTGAGTGG - Intergenic
1139954661 16:70687300-70687322 GGTCCCTGCACTCACCTGAGTGG - Intergenic
1139997462 16:70994525-70994547 GTTCTCTGCCCCTAATGGAGTGG - Intronic
1146708104 17:35016951-35016973 GCTCTCTCCCCTTAATGGAGGGG - Intronic
1151705328 17:75764311-75764333 GGACTCTGCCCTGAGCTGTGGGG + Intronic
1151911787 17:77088380-77088402 GGTCTTTGCACTTAATTCAGAGG + Intronic
1153828412 18:8898310-8898332 GGTCTCTGCTCTTATATGGGTGG - Intergenic
1160080847 18:75725788-75725810 GGTCTCTGCATTTATCTGAGAGG - Intergenic
1161975729 19:7606992-7607014 AATCTCGGCCATTAACTGAGAGG + Intronic
1164705640 19:30317384-30317406 TGTGTCTGCCCTGAACTCAGAGG - Intronic
925762913 2:7203987-7204009 AGTTTCTACCCTTAGCTGAGCGG - Intergenic
926811972 2:16763414-16763436 TGTCTCTCACCTTAAGTGAGAGG + Intergenic
927572617 2:24173159-24173181 GCTCTCTGCCCTAAAGTTAGTGG + Exonic
936910420 2:117585739-117585761 GGTCTTTTCCCTTATCTTAGAGG - Intergenic
938397699 2:130963371-130963393 GGTCTCTGCCCTGGGCCGAGCGG + Intronic
942128781 2:172856650-172856672 GTTCTTTCTCCTTAACTGAGTGG + Intronic
946947599 2:224837658-224837680 GTTTTCTCCCTTTAACTGAGTGG - Intronic
948291571 2:236828931-236828953 GGACTTTGCCCTTAACTCACGGG + Intergenic
1175825944 20:61936582-61936604 GCTCTCTGCATTTAACTGAAGGG - Intronic
1175876878 20:62234477-62234499 CTTCTCTGCCCTTCACTGCGGGG + Intronic
1179922718 21:44515876-44515898 GGTCTCAGCCCTTCACTCATGGG - Intronic
1181443729 22:22952498-22952520 GGTCTCTGCCCTTGACAGATTGG - Intergenic
1182003920 22:26943467-26943489 GGTGTCTGCTCTTAACTCTGGGG - Intergenic
1184039891 22:41936586-41936608 GGCCCATGCCCTTCACTGAGGGG - Intergenic
951850709 3:27136876-27136898 GGTAGCTGCCCTAAACTGAGGGG - Intronic
952594893 3:35005363-35005385 GTTATGTGCCCTTAAATGAGTGG - Intergenic
952735858 3:36690973-36690995 GGCCTTTGCCCTTAATTTAGAGG - Intergenic
952860922 3:37811632-37811654 GGTCTCTCTCCTTCACTGAGTGG - Intronic
955510003 3:59670035-59670057 GATATCTTCCCTTAAATGAGAGG + Intergenic
956329408 3:68089006-68089028 GGTGGCTGCCATTCACTGAGTGG + Intronic
957801070 3:85082538-85082560 GATTTGTGCCATTAACTGAGAGG - Intronic
958040340 3:88219689-88219711 GGTCTTTGCCCTCCACTGGGTGG + Intergenic
958040358 3:88219738-88219760 GGTCTTTGCCCTCCACTGGGTGG + Intergenic
960002977 3:112752189-112752211 GTTCTCTGCCCTTGAGTCAGAGG + Intronic
961357564 3:126348761-126348783 TGTCTCTTCCCCTTACTGAGTGG - Intronic
962341692 3:134591025-134591047 GGTCTCTGTCCCTCACTGGGTGG + Intergenic
970830532 4:20334501-20334523 GATATCTGCCCTTAACTGGGTGG + Intronic
972289543 4:37678585-37678607 GGCCTCTGCCATTACTTGAGGGG - Intronic
972360305 4:38320288-38320310 GGCCTCTGCCCCTATGTGAGGGG + Intergenic
974692562 4:65316584-65316606 GGTCTCTGACCTTCACTTAGAGG + Intergenic
975653836 4:76621170-76621192 AGACTCTGCCCTTGACTGACAGG - Intronic
981756700 4:148147686-148147708 GCACTCTGCCCTCAAGTGAGTGG + Intronic
984885261 4:184444078-184444100 GGTCTCTGCCCTGCCCTTAGGGG - Intronic
989640204 5:43576872-43576894 GGGCTCTGCCCAGAACTCAGTGG - Intergenic
989693131 5:44169725-44169747 GGTCTCTGCACATGGCTGAGTGG - Intergenic
989816919 5:45748482-45748504 GGTCCCTGCCCCTGACTGGGAGG - Intergenic
990195711 5:53312907-53312929 GGTCTGAGCCTTCAACTGAGAGG - Intergenic
990906675 5:60811059-60811081 TGCTTCTGCCCTTTACTGAGAGG + Intronic
991078555 5:62569226-62569248 TGTCTCTGCCCTTTACTGCCTGG + Intronic
991569208 5:68036723-68036745 TGTCTCTGCTCTTCCCTGAGTGG + Intergenic
992889173 5:81188198-81188220 GGTCTCTGCCCCTTAAAGAGCGG + Intronic
995449228 5:112281691-112281713 GCATTCTGCCCTCAACTGAGGGG - Intronic
997975875 5:138440967-138440989 GGCCACTGCCCTTGGCTGAGAGG + Intronic
998943342 5:147310164-147310186 TGTCTCTGCTCTTATCTCAGGGG - Intronic
1002811725 6:637686-637708 GGCCTCTGCCCTTACCTATGAGG + Exonic
1004533276 6:16474549-16474571 GGTCTTGGCCCTTAACTGTTGGG + Intronic
1006460935 6:34157625-34157647 GGTCACTGCTGTTCACTGAGAGG + Intergenic
1010554146 6:77258273-77258295 GACCTCTGCCCAGAACTGAGGGG - Intergenic
1010713732 6:79205189-79205211 GGTCTGTTCCCTTAACTGCCTGG + Intronic
1012476137 6:99616340-99616362 GGTACCTGCCCTTAGCTAAGAGG - Intergenic
1018626514 6:165784258-165784280 GGTGTTTGCCTTTAACTCAGTGG + Intronic
1018964789 6:168475886-168475908 GGTCTGTGTCGTTAACTGAGGGG + Intronic
1021574836 7:22097407-22097429 GGACTCTGCCCTTCCCTGAAAGG + Intergenic
1031871947 7:127097167-127097189 GGTCCCTGCGCTTAACTCTGTGG - Intronic
1042269625 8:66941935-66941957 GGAATCTGCCCTTAACCAAGAGG + Intergenic
1043024893 8:75053713-75053735 TGTATTTGCACTTAACTGAGAGG + Intergenic
1046642261 8:116745560-116745582 GGTGTCTGACCTTAACAGAAAGG + Intronic
1046853306 8:119000440-119000462 GGTCTGTGCCTGTATCTGAGAGG - Intronic
1049160732 8:141096013-141096035 GGCCTCTGCCCCTACCTGTGGGG - Intergenic
1049274229 8:141711650-141711672 GGTGTCTGCCCTAACCTGGGTGG + Intergenic
1056356637 9:85806797-85806819 GGTCTCAGTACTTAACTGTGAGG + Intergenic
1062610192 9:137370061-137370083 GGGCTCTGCCCTTACCAGGGTGG - Intronic
1062630664 9:137461735-137461757 GGTCCCTGCCCTTACTTGGGGGG - Intronic
1186227208 X:7412495-7412517 GGTCCCAGCCCATACCTGAGGGG + Intergenic
1189588313 X:42484712-42484734 GCTTTCTGCCCTTAACTAAAAGG + Intergenic
1191031871 X:55982317-55982339 GGCCTCTGACCTTAATTGATAGG - Intergenic
1194867341 X:99085622-99085644 GGTCTCTGCACATGCCTGAGTGG - Intergenic
1195233874 X:102878005-102878027 GGTCTCTGAGGTTAACTGTGGGG - Intergenic
1195878263 X:109564730-109564752 GGGCTCTGCCCTGAGCTCAGTGG + Intergenic