ID: 1122609280

View in Genome Browser
Species Human (GRCh38)
Location 14:102970136-102970158
Sequence CCCGCCCAGCACTACCTTGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 72}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122609274_1122609280 1 Left 1122609274 14:102970112-102970134 CCCTCTCAGTTAAGGGCAGAGAC 0: 1
1: 0
2: 0
3: 11
4: 160
Right 1122609280 14:102970136-102970158 CCCGCCCAGCACTACCTTGAGGG 0: 1
1: 0
2: 0
3: 6
4: 72
1122609275_1122609280 0 Left 1122609275 14:102970113-102970135 CCTCTCAGTTAAGGGCAGAGACC 0: 1
1: 0
2: 0
3: 11
4: 109
Right 1122609280 14:102970136-102970158 CCCGCCCAGCACTACCTTGAGGG 0: 1
1: 0
2: 0
3: 6
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122609280 Original CRISPR CCCGCCCAGCACTACCTTGA GGG Exonic
900509615 1:3052396-3052418 CCCGCCCAACACAACTCTGAGGG - Intergenic
902287173 1:15414161-15414183 CCCGCCTAGCACAGCCTTGCAGG + Intronic
902533387 1:17104919-17104941 CTCGCCCAGCACCACCCTGCGGG - Exonic
905225849 1:36478727-36478749 CATGCCCTGCACTACCTTGGAGG + Intronic
905704605 1:40045418-40045440 CCCACCCAGAAATTCCTTGAAGG - Intronic
906681098 1:47725852-47725874 CCCGCTCAGCAGTGCCCTGAAGG - Intergenic
907522493 1:55033341-55033363 CCAGCCCAGCTCTTCCTTGCAGG + Intergenic
916188330 1:162154534-162154556 CCCCTCCAGCCCTACCTAGAAGG - Intronic
919781256 1:201222651-201222673 CCCCTCCAGCCCTACCTTGCTGG + Intronic
921371273 1:214425125-214425147 CTAGCCCAGAAGTACCTTGAAGG + Intronic
1069664151 10:70143841-70143863 CCCGCTGAGCACTTCCATGAAGG - Exonic
1071461073 10:85896344-85896366 CCAGCCCAGCTCTAACTTAATGG - Intronic
1073473950 10:103740842-103740864 TCCACCCAGCACTGTCTTGATGG + Intronic
1078670869 11:13364018-13364040 CCTGCCCAGCATTACCTCCAGGG + Intronic
1091682349 12:2536118-2536140 GGGGCCCAGCACTACCTTGAAGG - Intronic
1091980163 12:4858243-4858265 CCAGCCCAGCCCTCCCTTGCTGG - Intergenic
1101626453 12:106447566-106447588 CTCGCTCAGCACTACCAGGAAGG + Intronic
1103866001 12:124052604-124052626 CCAGCCCGGCGCTACCATGATGG + Intronic
1111937686 13:94573373-94573395 CCACCCCAGAACTACCATGATGG + Intergenic
1122609280 14:102970136-102970158 CCCGCCCAGCACTACCTTGAGGG + Exonic
1128547864 15:68579605-68579627 CCCGCCGCGCACTCCCTGGAGGG - Intronic
1129446785 15:75624718-75624740 CCCGCCAAGAACAGCCTTGAAGG - Exonic
1132353411 15:101154563-101154585 CCCACCCAGCCCAACCCTGATGG - Intergenic
1132682485 16:1148846-1148868 CCCGCCCAGCACGGTCTCGAGGG + Intergenic
1133011165 16:2912420-2912442 CCCGCCCAGCGCTGCCTTCCTGG + Intronic
1134419118 16:14070212-14070234 GGAGCCCAGCACTACCTTGTAGG - Intergenic
1135669351 16:24361885-24361907 CACGCCCAGCACAGCCTTGGGGG + Exonic
1137674812 16:50299025-50299047 CCCGCCCAGGACCTACTTGATGG - Exonic
1141604260 16:85144025-85144047 CCCGCACGGCACTCCCTTGCTGG - Intergenic
1141643062 16:85352698-85352720 CCTGCTCAGCACCATCTTGAAGG - Intergenic
1151421471 17:74000872-74000894 CCCCCCCACCACCACCTTCAGGG + Intergenic
1157294987 18:46435822-46435844 CCCACCCAGCACTGCCTTGCTGG - Intronic
1159502126 18:69286788-69286810 CCCTCCCAGCACTGCCATGTTGG + Intergenic
1160155623 18:76431957-76431979 CCCGCCCACCACTGCCCTGGCGG + Intronic
1166127996 19:40727710-40727732 ACAGCTCAGGACTACCTTGAAGG + Intronic
1168160002 19:54503778-54503800 CCCACCCAGCACTGCCTTTGGGG - Intronic
1168713341 19:58513841-58513863 CCAGCCCGGCACCACCTGGAGGG + Exonic
935146598 2:100399676-100399698 CCCACCCAGCTCTTCCTTTATGG + Intronic
936146956 2:109986662-109986684 CCAGCCCAGCACCACCTGGAAGG + Intergenic
936197736 2:110384821-110384843 CCAGCCCAGCACCACCTGGAAGG - Intergenic
938116149 2:128604084-128604106 CCAGCCCAGCAGGACCATGATGG + Intergenic
939839790 2:147173130-147173152 CCTGCCCAGCCCTGCCTTGCTGG + Intergenic
945236171 2:207633617-207633639 ACTGCTCAGCGCTACCTTGAGGG + Intergenic
1172448067 20:35003375-35003397 CCCACCCATCACCCCCTTGAGGG + Intronic
1172530176 20:35625639-35625661 CCAGCCCAGCTCTGCCCTGAGGG + Intergenic
1175806063 20:61830046-61830068 CCCCCACAGCCCTACCTTCATGG + Intronic
1175880979 20:62258945-62258967 CCACCCCAGCACTGCCTTTATGG + Intronic
1175996184 20:62813246-62813268 CCCGCCCAGCAGGACCTGCAGGG + Exonic
1178403875 21:32309293-32309315 ACAGCCCAACATTACCTTGAAGG + Intronic
1180989402 22:19925868-19925890 CCGGCCCTGCACTTTCTTGATGG - Intronic
1183201111 22:36386727-36386749 CACCCCCAGCACTAGCTTGCCGG - Intronic
950451141 3:13066569-13066591 CCTGCCCAGCCCTGCCTGGAAGG - Intronic
954394969 3:50288604-50288626 CGAACCCAGCACTTCCTTGAAGG + Exonic
954715334 3:52524010-52524032 CCAACCCAGCCCTACCTGGAAGG - Exonic
956920139 3:73919422-73919444 ACCGCCCAGCCCTTTCTTGACGG - Intergenic
966769892 3:183494375-183494397 CCAGGCCAGCCCTACCCTGAGGG + Intronic
973145731 4:46823165-46823187 CCCACCCAGCAGAACCTTGGAGG - Intronic
986506537 5:8457806-8457828 CCCGCCTAGCACTGGCCTGATGG + Intergenic
986661011 5:10060248-10060270 CCAGCCAAGCTCTACCATGAAGG + Intergenic
989133769 5:38133283-38133305 CCTGCACAGCACTGCCTTGTCGG + Intergenic
990338281 5:54796366-54796388 CCCTCCCATCTCTTCCTTGAGGG + Intergenic
1002194908 5:177496483-177496505 CCCCTCCAGCACTACTTTGAAGG + Exonic
1007762000 6:44138753-44138775 CCTGCCCTGCCCCACCTTGAGGG + Intronic
1018728151 6:166628994-166629016 CCCTCCCAGCAGAACCTTAAAGG - Intronic
1027269805 7:76513156-76513178 CCTGCCCAGCGCTACCTTGGTGG - Intronic
1028880775 7:95877249-95877271 TCAGCCCAACACTAACTTGAGGG + Intronic
1029445853 7:100612544-100612566 CCCGCCGAGCCCCACCTCGACGG - Exonic
1040336486 8:46418657-46418679 CCCGCCCAGGACAGCCCTGAGGG - Intergenic
1040456047 8:47599017-47599039 CCCAACCAGCACTCCCCTGAGGG + Exonic
1041607552 8:59800736-59800758 ACTGCTCAGCATTACCTTGAAGG - Intergenic
1046115610 8:109779823-109779845 CCAGCCAAGCATCACCTTGATGG - Intergenic
1047780740 8:128109108-128109130 CCAGCCCAGCACTGGCTCGAGGG - Intergenic
1049059056 8:140261875-140261897 CCTGCCCAACACAACCTGGAAGG + Intronic
1052376986 9:27728716-27728738 CACGCACAGCACGAGCTTGAGGG + Intergenic
1056757560 9:89391487-89391509 GCCGGCCAACACTACCTTGGGGG + Intronic
1061403594 9:130381867-130381889 CACCCCCAGCACTGCCATGAAGG + Intronic
1061422944 9:130481994-130482016 CCCTCCCAGCTCTCCCTGGAGGG - Intronic
1062219337 9:135406016-135406038 CCCTCCTGGCACTAGCTTGATGG - Intergenic
1062609397 9:137367208-137367230 CCTGCCCAGCAGTGCCTTGGGGG + Intronic