ID: 1122613459

View in Genome Browser
Species Human (GRCh38)
Location 14:103001248-103001270
Sequence GGCTGGCGGGGCCACAGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 290
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 262}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122613459_1122613474 25 Left 1122613459 14:103001248-103001270 CCCTCACTGTGGCCCCGCCAGCC 0: 1
1: 0
2: 1
3: 26
4: 262
Right 1122613474 14:103001296-103001318 GCACGAGACAGCGAGGTCCCTGG 0: 1
1: 0
2: 2
3: 10
4: 111
1122613459_1122613471 -1 Left 1122613459 14:103001248-103001270 CCCTCACTGTGGCCCCGCCAGCC 0: 1
1: 0
2: 1
3: 26
4: 262
Right 1122613471 14:103001270-103001292 CCCTCTGGCAACAGGGGTGCTGG 0: 1
1: 2
2: 0
3: 20
4: 222
1122613459_1122613466 -8 Left 1122613459 14:103001248-103001270 CCCTCACTGTGGCCCCGCCAGCC 0: 1
1: 0
2: 1
3: 26
4: 262
Right 1122613466 14:103001263-103001285 CGCCAGCCCCTCTGGCAACAGGG 0: 1
1: 1
2: 2
3: 17
4: 169
1122613459_1122613465 -9 Left 1122613459 14:103001248-103001270 CCCTCACTGTGGCCCCGCCAGCC 0: 1
1: 0
2: 1
3: 26
4: 262
Right 1122613465 14:103001262-103001284 CCGCCAGCCCCTCTGGCAACAGG 0: 1
1: 1
2: 1
3: 18
4: 211
1122613459_1122613467 -7 Left 1122613459 14:103001248-103001270 CCCTCACTGTGGCCCCGCCAGCC 0: 1
1: 0
2: 1
3: 26
4: 262
Right 1122613467 14:103001264-103001286 GCCAGCCCCTCTGGCAACAGGGG 0: 1
1: 0
2: 1
3: 21
4: 307
1122613459_1122613473 18 Left 1122613459 14:103001248-103001270 CCCTCACTGTGGCCCCGCCAGCC 0: 1
1: 0
2: 1
3: 26
4: 262
Right 1122613473 14:103001289-103001311 CTGGCATGCACGAGACAGCGAGG 0: 1
1: 0
2: 0
3: 12
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122613459 Original CRISPR GGCTGGCGGGGCCACAGTGA GGG (reversed) Intronic
900382556 1:2392035-2392057 GGCGGGCGGGGCCGCGCTGAGGG + Intronic
900675794 1:3885169-3885191 GGGTGGCGGGTGCACAGAGACGG + Exonic
901441579 1:9281504-9281526 GCCTGGCGGGGACACAGACAAGG + Intergenic
901635336 1:10667829-10667851 GGCTGGGTGGGCCAAAGTGCGGG - Intronic
902403007 1:16168046-16168068 GGCTGGCGGGGCCCAAGGGGAGG - Intergenic
902802744 1:18840400-18840422 GGCCAGCAGGGCCACAGCGATGG + Exonic
902804003 1:18849549-18849571 AGCTGGCGGGGTCAGAGGGAAGG + Exonic
903305478 1:22409986-22410008 GGCTGCCACAGCCACAGTGATGG + Intergenic
904494885 1:30880942-30880964 ACCTGGAGGGGGCACAGTGAGGG - Intronic
904585828 1:31579991-31580013 GGGTGCCCGGGTCACAGTGAGGG + Intronic
905290902 1:36921069-36921091 GGCTGGGAGGGCCAGAGAGAGGG + Intronic
905733421 1:40311422-40311444 GGGAGGCGGGGCCACGGAGATGG - Intronic
905733430 1:40311444-40311466 GGGGGGCGGGGCCACAGAGATGG - Intronic
906194953 1:43924243-43924265 GACTTTCGGGGCCACGGTGATGG - Intronic
906315587 1:44784673-44784695 GGCCGCCGTGGCCACAGTGTAGG + Exonic
906402973 1:45519478-45519500 GGCAGGTGGAGGCACAGTGATGG - Intronic
907341250 1:53737977-53737999 GGCTGGCGGGGCCGCGGTCGGGG + Intergenic
907395900 1:54189723-54189745 GGCAGGAGGGGCCACAGGGCAGG - Intronic
910935014 1:92480490-92480512 GGCGGGTGGGGCCAGAGAGAAGG + Intronic
914431181 1:147621013-147621035 GGCTGGGGAGGCCATGGTGAGGG - Exonic
914808500 1:151008994-151009016 GGCTGGCGGCGGCACAGTCCTGG - Intronic
916170466 1:161998024-161998046 GGCTGTGTGGGCCACAGTGGTGG + Exonic
916586357 1:166153535-166153557 GGCAGGCAGGACAACAGTGAAGG + Intronic
918177886 1:182061163-182061185 GGCAGGCAGGGGCACAGGGAGGG + Intronic
919751696 1:201041735-201041757 GGCTGGCTGGGGCACAGTGGTGG - Intronic
1063188344 10:3670210-3670232 GGCAGGAGGGGCCCCTGTGAAGG - Intergenic
1067821884 10:49538181-49538203 GGCTGCGGGAGCCCCAGTGATGG - Intronic
1068656736 10:59583642-59583664 GGCTGGAGGGGAGAGAGTGAAGG - Intergenic
1069708364 10:70473450-70473472 GGCTGTCGGGGAGAGAGTGAGGG - Intergenic
1069774262 10:70917724-70917746 GACTGGTGGGGCCAGAGAGAGGG - Intergenic
1073070649 10:100791151-100791173 GGCAGGCGGAGCCTCAGGGAGGG - Intronic
1073594688 10:104787968-104787990 GGCTGCCCAGGCCACATTGATGG - Intronic
1074897998 10:117793642-117793664 GGCTGGCAGGGCCAGAGAGCAGG - Intergenic
1075485409 10:122818628-122818650 GGCGGGCGGAGCCGCTGTGAGGG + Intergenic
1076704459 10:132293666-132293688 GGCAGGCAGGGCCAGAGTGGGGG + Intronic
1076761651 10:132608822-132608844 GGCTGGGGAGGCCAGAGTGGAGG + Intronic
1076775879 10:132697761-132697783 GGTTGGATGGGGCACAGTGATGG + Intronic
1076777622 10:132706799-132706821 GGCTGCAGGGGCCACTGTGCTGG + Intronic
1077013996 11:392067-392089 GTCTGGCCCGGCCGCAGTGAGGG + Intergenic
1077135847 11:998073-998095 GGCTGTGGAGGCCACAGTGTTGG + Intronic
1077333239 11:1992600-1992622 GGGTGGCGGGGCCGGGGTGAGGG - Intergenic
1077339737 11:2020965-2020987 AGCTGGCGGGGCCACAGGTGGGG + Intergenic
1077896566 11:6457651-6457673 GGCTGGTGGGGCCACAGGGATGG - Intronic
1078151371 11:8762250-8762272 GGCTGGAGTGGAGACAGTGAAGG - Intronic
1078457552 11:11486957-11486979 GGCTGGGGAAACCACAGTGAGGG - Intronic
1078609710 11:12809726-12809748 GGCTGGCTGGGCCACTGTTAAGG + Intronic
1078884319 11:15484882-15484904 GACTGGCTGGGCCACAATCATGG - Intergenic
1080224243 11:29942932-29942954 GGCTGGTGGGGCAGCAGGGAAGG - Intergenic
1080268891 11:30429555-30429577 GGTTGGCTGGCACACAGTGAGGG - Intronic
1081570341 11:44286775-44286797 GGATGCTGGGGCCACAGTGTGGG - Intronic
1083298580 11:61728346-61728368 CGCTGCAGGGGCCACAGGGAAGG - Intronic
1083430315 11:62610991-62611013 GCCTGGTGGGGGCATAGTGAAGG + Exonic
1083653695 11:64219167-64219189 GGCTGGCAGGGGCTCAGTGCAGG + Intronic
1084410767 11:69004902-69004924 TGCTGGCTGGGACACAGTCAAGG + Exonic
1085531323 11:77193932-77193954 TGCTGGCAGGGTCAGAGTGAGGG - Intronic
1088973539 11:114794610-114794632 GGCTGCAGGGACCACAGTAAAGG + Intergenic
1089217051 11:116840774-116840796 GGCTGCGGGGCCCACAGTGTAGG + Intergenic
1089286527 11:117411207-117411229 GGCTGGAGGGGCTAGAGGGAGGG - Intronic
1090611754 11:128477531-128477553 GGTTGGCGGGGGCACCATGAGGG + Intronic
1090645126 11:128761065-128761087 GGATGGTGGGGCCACACTAAGGG - Intronic
1202816219 11_KI270721v1_random:47781-47803 GGGTGGCGGGGCCGGGGTGAGGG - Intergenic
1202822722 11_KI270721v1_random:76154-76176 AGCTGGCGGGGCCACAGGTGGGG + Intergenic
1093619052 12:21265316-21265338 GGCAGGGTGGGACACAGTGAAGG + Exonic
1096053087 12:48628348-48628370 TGCTGCCAGGGCCATAGTGAAGG - Intergenic
1097288030 12:57892629-57892651 AGCTTGCGGGGACACAATGATGG + Intergenic
1099304415 12:80937085-80937107 GGCTGCCGGGCGCACAGTGGCGG - Intronic
1099709037 12:86196385-86196407 GGCTGCCCAGGCCACAGGGATGG - Intronic
1102567387 12:113805455-113805477 AGCTGGTTGGACCACAGTGAGGG + Intergenic
1103534848 12:121627131-121627153 GGCCGGGCGGGCCAGAGTGAGGG + Intronic
1105315991 13:19263923-19263945 GGCTGGCAGGTCCATAGGGACGG + Intergenic
1105946352 13:25193068-25193090 GGCTGGCGGGGCAGTGGTGAGGG + Intergenic
1112284167 13:98089296-98089318 GGCTGGTGGCACCCCAGTGAAGG - Intergenic
1113370269 13:109718041-109718063 GGCTGGCTGGGTCATCGTGAAGG - Intergenic
1113911794 13:113845141-113845163 GGCAGGCCGGGCCACAGGGCAGG + Intronic
1115028153 14:28766498-28766520 GGGTGGCGGGGGCGCAGGGAAGG + Intergenic
1117137312 14:52749089-52749111 GGCTGGCAAGTCCACAGTCATGG + Intronic
1119635371 14:76269017-76269039 GGATGGCGGACCCACAGTGCTGG + Intergenic
1120056380 14:79929240-79929262 GGGTGGCAGGGACAAAGTGATGG - Intergenic
1121098242 14:91232957-91232979 GGCTGGAGGTGCCCCAGGGAAGG - Exonic
1122290210 14:100676731-100676753 GGGTGTGGGGGCCACAGTCACGG - Intergenic
1122613459 14:103001248-103001270 GGCTGGCGGGGCCACAGTGAGGG - Intronic
1122721276 14:103723927-103723949 GGGTGGCGGGGACATGGTGAGGG + Intronic
1122776078 14:104117495-104117517 GGCGGGCGCGGCGACAGCGACGG + Intergenic
1122945719 14:105007968-105007990 GGCTGGCGGAGCCACCGGAAAGG - Intronic
1122972495 14:105158109-105158131 GGCTGGAGTGGCCACAGACAGGG + Intronic
1124063329 15:26316606-26316628 GGCTGGGAGGGCAACAGAGAAGG - Intergenic
1124693675 15:31845955-31845977 GGATGGCGGCCCCACAGTGTGGG + Intronic
1126163544 15:45635014-45635036 GGCGGGCGGGGCCCCAGTCCAGG + Exonic
1126331209 15:47533670-47533692 GTCTGGTGGGGGCACAGTCAAGG - Intronic
1127137458 15:55939391-55939413 GGCTGGGGAGGCCTCAGTCATGG - Intronic
1128113057 15:65088511-65088533 TGCTGGCAGTGACACAGTGAAGG - Intergenic
1128228342 15:66018151-66018173 GGCTGGCTGGGCCACAGAGCCGG + Intronic
1129698584 15:77754676-77754698 GGCTGGAGGGGCCACTCTGCAGG - Intronic
1130554134 15:84910987-84911009 TGCTGGCGTGTCCACAGTGCAGG + Intronic
1131117389 15:89803578-89803600 GCCTGGAGGGGCCTCACTGAAGG - Intronic
1132672271 16:1106723-1106745 GCACGGCGGGGCCACAGTGGGGG - Intergenic
1133136695 16:3717369-3717391 GGCGGGCCGGGCCACGGAGACGG - Intronic
1133417393 16:5616911-5616933 AGCTGGCTGAGCCAAAGTGAGGG - Intergenic
1134359948 16:13522072-13522094 GGCTGGTGGGGACAGAGTGTGGG - Intergenic
1136377365 16:29873254-29873276 GGCTGGCTGGTCCACTGGGAGGG + Exonic
1139923232 16:70472493-70472515 GGCTGCAGGGGCCACAGGAAAGG - Intronic
1139951789 16:70676003-70676025 GGGTGGCCGTCCCACAGTGAAGG - Intronic
1140228468 16:73097731-73097753 GGCTGGAGGGGCCACGGGGACGG - Intergenic
1140281447 16:73558603-73558625 GGCTGGAGGGACCACGGTGAAGG + Intergenic
1140521395 16:75584993-75585015 GGCTTGAGGAACCACAGTGAGGG - Intergenic
1141967155 16:87453231-87453253 GGCCCGCTGGGCCACAGTCATGG + Intronic
1142669144 17:1479511-1479533 GGCAGGCGAGGACACGGTGAGGG + Intronic
1144422777 17:15113174-15113196 GTTCCGCGGGGCCACAGTGAGGG + Intergenic
1145971772 17:28960458-28960480 GGGTGGCGGGTCCACGGGGATGG - Intronic
1147307904 17:39576347-39576369 GCCTGGAGACGCCACAGTGAGGG - Intergenic
1147604016 17:41763772-41763794 GGGTGGTGGGGCAGCAGTGAAGG - Intronic
1150137046 17:62701853-62701875 GGGTGGCTGGGCCTCAGGGATGG - Intronic
1152036316 17:77875237-77875259 GGCTGGAGGGGCCTCAGGAATGG - Intergenic
1156491979 18:37501692-37501714 GGCTGCCTGGGCCTCAGTGGAGG + Intronic
1157021213 18:43784420-43784442 GGGTGGTGGGGCCACAGGGCGGG + Intergenic
1157223078 18:45840825-45840847 GGCTGGAGGTGCCACACTGCTGG + Intronic
1157892076 18:51427413-51427435 GGCTGGAGGGGAAACAGGGAGGG - Intergenic
1158186848 18:54780462-54780484 GGATGGGGGAGACACAGTGAGGG - Intronic
1160160414 18:76466280-76466302 GGCAGGCAGGGGCACAGGGAGGG + Intronic
1160183330 18:76655039-76655061 GGCTGGCAAGTCCACAGTCAAGG + Intergenic
1161156039 19:2732358-2732380 GGCTGCTGTGGCCAGAGTGAGGG - Intronic
1161436896 19:4268870-4268892 GGCTGGTGAGGGCACAGAGAAGG - Exonic
1162909722 19:13842462-13842484 GGGTGGAGGGGCCACTGGGAAGG + Intergenic
1164668844 19:30061749-30061771 CGATGGTGGGGCCACAGTGCAGG + Intergenic
1165060885 19:33204728-33204750 GGATGGCGGAGCCACAGAGGCGG - Exonic
1165652956 19:37507170-37507192 GCCTCGCGGGGCCTCAGTGGTGG + Intronic
1166300717 19:41910654-41910676 GGGTGGAGGGGACACAGGGACGG - Intronic
1167144626 19:47674245-47674267 GGCTGATGGGGCCAAACTGAAGG + Intronic
1167213916 19:48151286-48151308 GGCTGAAGTGGCCACAGAGAAGG - Exonic
1167513449 19:49909220-49909242 TGCTGGCGTGGCCGGAGTGAAGG + Exonic
1168686064 19:58350344-58350366 AGCTGGCGGGGCACCAGCGAGGG - Intronic
925379682 2:3416571-3416593 GGCAGGGGAGGGCACAGTGAAGG - Intronic
925379699 2:3416618-3416640 GGCAGGGGAGGGCACAGTGAAGG - Intronic
926147233 2:10404266-10404288 GGCTGGCGGGGACACAGCTGGGG - Intronic
928850798 2:35743292-35743314 GGCTGGGGAGGCCTCAGTCATGG - Intergenic
931143104 2:59485315-59485337 GGATTGCTGAGCCACAGTGAGGG - Intergenic
931358808 2:61560197-61560219 GGGAGGCTGGGCCACAGAGAGGG - Intergenic
934560929 2:95312940-95312962 GGCTGGTGTGGTCACACTGAGGG + Intronic
935175853 2:100648205-100648227 AGCAGGCGGGTCCCCAGTGAGGG + Intergenic
936756727 2:115722890-115722912 GGCTGGAGGGGCCAAAGTGGTGG + Intronic
936947037 2:117940435-117940457 GACTGGCAAGGCCAGAGTGAGGG + Intronic
938566304 2:132522085-132522107 AGCCGGCGGGGCCACAGGGAAGG - Intronic
939760129 2:146165488-146165510 GGCTGGCGAGGCCTCACTCATGG + Intergenic
940311207 2:152280335-152280357 GTCTGTGGAGGCCACAGTGATGG + Intergenic
948273674 2:236692401-236692423 GCTTGCCAGGGCCACAGTGAGGG + Intergenic
948536355 2:238650403-238650425 GGCTAACGGGCCCACAGAGAGGG + Intergenic
948834850 2:240620934-240620956 GCCTGGCGGTGTCACTGTGAGGG - Intronic
1169091876 20:2865788-2865810 GGGTGGAGGGGGCACAGGGAGGG + Intronic
1169093148 20:2873564-2873586 GACTGGGCGGGCGACAGTGATGG - Intronic
1170109021 20:12784716-12784738 GGTTGGGGTGGCCAGAGTGATGG - Intergenic
1171112138 20:22494140-22494162 GGCTGGGGTGGCCAGAGTGGTGG - Intergenic
1171253367 20:23667655-23667677 GGCTGGCATGGCCACAGGGAAGG + Intergenic
1171259842 20:23722909-23722931 GGCTGGCATGGCCACAGGGAAGG + Intergenic
1171268919 20:23798440-23798462 GGCTGGCGTGACCACAGGGAAGG + Intergenic
1171374283 20:24681704-24681726 GGCTGGCTGGGTCAGTGTGATGG - Intergenic
1172356769 20:34285640-34285662 CGCAGGCAGGGCAACAGTGAAGG + Intronic
1172847850 20:37940487-37940509 TGCTGGCAGGGCCACAGGGAAGG - Intronic
1174420907 20:50398773-50398795 GTCTGGCAGGGACACTGTGACGG - Intergenic
1175542094 20:59754371-59754393 GGATGGAGGGGCCACAGAGCCGG - Intronic
1175681784 20:60994683-60994705 GGGTGGTGGGAACACAGTGAAGG - Intergenic
1175789960 20:61734998-61735020 GCCGGGAGGGGCCACAGGGAGGG - Intronic
1176005592 20:62860981-62861003 GGCTGGCGGGGCCCGGGTGGAGG - Intronic
1176054041 20:63135004-63135026 GGGAGGCGGGGCCACAGGGGAGG + Intergenic
1176054167 20:63135304-63135326 GGGAGGCGGGGCCACAGGGGAGG + Intergenic
1179317037 21:40253166-40253188 GGATGGTTGGTCCACAGTGAGGG + Intronic
1179576311 21:42310532-42310554 GGCCGGGGGGACCACAGTGCAGG + Intergenic
1180218799 21:46344731-46344753 TGCAGGGAGGGCCACAGTGACGG + Intronic
1181804404 22:25366286-25366308 GGCTGGAGGGGTGGCAGTGAGGG + Intronic
1182036497 22:27202762-27202784 GGCTGGTGGGGCCCCGGGGAGGG - Intergenic
1182124610 22:27807434-27807456 GGCTCCTGGGGCCACAGTGAAGG - Intergenic
1182345540 22:29661393-29661415 GGCTGGGGAGGCTCCAGTGAGGG - Intronic
1183011120 22:34947433-34947455 GTGTAGCTGGGCCACAGTGAGGG + Intergenic
1183358035 22:37369830-37369852 GGCAGGGGGGGCCACAGGGAGGG - Exonic
1183513234 22:38248131-38248153 GGCTGGCTGGGACAGGGTGATGG - Intronic
1183600476 22:38837281-38837303 GGCTGGAGGGGGCACTGTGGGGG + Intronic
1184021823 22:41826303-41826325 GGCTGGTGGGGACACTGTGAGGG + Intergenic
1184449312 22:44573614-44573636 GGCTGCAGGGGCCTGAGTGATGG - Intergenic
1184472517 22:44703648-44703670 GGCTGGTGTGGGAACAGTGAAGG + Intronic
1184754508 22:46508420-46508442 GGGTGGGGGGGCCACAGGGTGGG - Intronic
1184865418 22:47199422-47199444 GGCCGGCGTGGCCAGAGGGAGGG - Intergenic
1185077911 22:48693181-48693203 GCCTGGAGGGGCCTCAGTGACGG + Intronic
950429035 3:12940470-12940492 GGCGGGCGGGGCCACAGGATGGG + Intronic
952882186 3:37991783-37991805 GGCTGGAGGGGGCACTGTGGGGG + Intronic
953148213 3:40299274-40299296 TGCTGGCAAGTCCACAGTGAAGG + Intergenic
953418003 3:42734038-42734060 GGCTGGCAGGGACTCAGTGAGGG + Intronic
953788866 3:45931167-45931189 GCCTGCCTCGGCCACAGTGATGG + Exonic
954405028 3:50340855-50340877 GCCGGGCGGGGCCACAGGGCGGG + Intronic
954615230 3:51966142-51966164 GGCTGGAGGGGCAGCAGTGATGG + Intronic
954655373 3:52191170-52191192 GGCTGAGGGGCCCCCAGTGAAGG - Intergenic
955387768 3:58492513-58492535 CGCTGGCGGGGCAGCAGCGAAGG + Intronic
957083107 3:75655580-75655602 GGGAGGAGGGGCCACAGAGAAGG + Intergenic
957083141 3:75655688-75655710 GGCCGGCGGAGCCACAGCCACGG + Intergenic
957417734 3:79928826-79928848 GTCTGGAGTGGCCACTGTGAGGG + Intergenic
960948882 3:122985761-122985783 GGCTGGCGTGGCCACCCTGTTGG - Intronic
961720892 3:128895373-128895395 CGCTGCCAGGGTCACAGTGATGG - Exonic
962343738 3:134605247-134605269 GGCTTCCAGGGCCACAGGGAGGG + Intronic
966882731 3:184359307-184359329 GGCTGTCCTGGCCAGAGTGATGG + Intronic
968230537 3:197002725-197002747 AGCTGGCGCGGCCACAGTGGGGG + Exonic
968919512 4:3515361-3515383 GGCAGGTGGGGCCACATGGAGGG - Intronic
968928007 4:3560113-3560135 GGCTGGTGGGGCCACAGGACTGG + Intergenic
968971992 4:3800684-3800706 GGCTGGGGGTTCCACAGGGAGGG + Intergenic
969314349 4:6372496-6372518 CACTGGCCAGGCCACAGTGAAGG + Intronic
969544776 4:7818561-7818583 GGCCTGCGGCGTCACAGTGATGG + Intronic
969696447 4:8737814-8737836 TGCTGGCGGGGCCACAGGGCTGG - Intergenic
970606993 4:17690337-17690359 TGTTGGAGGGGCCAGAGTGAAGG + Intronic
971868642 4:32206878-32206900 AGCTGGGGAGGCCACAGTCATGG + Intergenic
972165738 4:36281869-36281891 GGCTGGTGGGGCCACTTGGATGG + Intronic
975521202 4:75302626-75302648 GGCTCCCAGGTCCACAGTGATGG + Intergenic
977293760 4:95190839-95190861 GACTGGCCGGCCCAGAGTGAGGG + Intronic
978874473 4:113622422-113622444 AGCTGGAGGGGAAACAGTGAGGG - Intronic
980084868 4:128380598-128380620 GGCTGGCTGGGTCACATTGAAGG - Intergenic
981576518 4:146211704-146211726 AGCTGGCTGAGCCACAGAGAGGG - Intergenic
983859817 4:172691599-172691621 GTCTGGAGGGCCCACAGAGATGG + Intronic
986013955 5:3741034-3741056 GCATGGCAGGGCCACAGTGTAGG + Intergenic
991202168 5:64007145-64007167 GGATGGAGGGGCTACAGTCAGGG - Intergenic
992098350 5:73382212-73382234 CGCTGGCGGGGCCGCGGGGAGGG + Intergenic
994816255 5:104591730-104591752 AGCAGGAGGGGCCACAGGGATGG - Intergenic
995882574 5:116859227-116859249 GTCTGTTGGGGCCACAGAGAGGG - Intergenic
996088242 5:119325784-119325806 GGCTGGTGTGGCTACAGTGACGG - Intronic
996347940 5:122507754-122507776 GGCTAGCGTGGCTGCAGTGAGGG - Intergenic
997358498 5:133279629-133279651 GGGTGGAGGGGCCACAGGGCTGG + Intronic
997585436 5:135040499-135040521 GGCCTGCGGGGCCACAGGGGTGG - Intronic
998415885 5:141945813-141945835 GGAAGGAGGGGACACAGTGAGGG + Intronic
999868604 5:155728201-155728223 GGCTGGCGGGGCTGGAGGGAGGG - Intergenic
1001019827 5:168173483-168173505 GGCTGAGGGGGCGAAAGTGAAGG - Intronic
1002432948 5:179213585-179213607 GGCCGGAGGGGCCACACTGGGGG + Intronic
1003888208 6:10540004-10540026 GGAGGTCGGGGCTACAGTGAGGG + Intronic
1003971722 6:11306626-11306648 GGATGGTGGGGCCTCAGGGATGG - Intronic
1006180466 6:32150760-32150782 GGGTGGCGGTGCCAGACTGATGG + Exonic
1006317008 6:33297281-33297303 GGCTGTCTGGGCCCCAGTGGGGG - Intronic
1007254849 6:40521370-40521392 GGCTGGAGGAGCCAGAGAGAGGG + Intronic
1007667368 6:43523128-43523150 GGCTGGGGAGGCCAGACTGAGGG + Exonic
1008673338 6:53795044-53795066 GGCGGGCGGGGGTACAGGGACGG + Exonic
1011702836 6:89971659-89971681 GGCTGGGGAGGCCTCAGTCATGG + Intronic
1013179759 6:107708010-107708032 GGCTGGATGGGGCACAGAGAGGG + Exonic
1017497569 6:154995323-154995345 GGCGGCCGCGGCCACAGTTACGG - Intronic
1019022138 6:168928182-168928204 GGATGGAGGGGCCACAATGCTGG + Intergenic
1019290536 7:248077-248099 GGCTGGCGATGCCTCACTGATGG - Intronic
1019392466 7:796110-796132 GGCTGGAGGGGAAACAGGGACGG + Intergenic
1019574822 7:1732346-1732368 GGCTGACTGGGCATCAGTGAGGG - Intronic
1020207505 7:6130438-6130460 GGCTGGGGAGGCCATAGTGGTGG + Intronic
1020281532 7:6652594-6652616 GGCCGGCGGGGCCACTGCGGCGG - Exonic
1025014708 7:55429960-55429982 GGCTGGAGGAGCCACTGGGAGGG + Intronic
1026463076 7:70631726-70631748 GGTTGGCTGGGCCACAGCAAGGG + Intronic
1026765234 7:73155626-73155648 GGCTGGGGCGGCTGCAGTGACGG + Intergenic
1027041708 7:74965382-74965404 GGCTGGGGCGGCTGCAGTGACGG + Intronic
1027081934 7:75236987-75237009 GGCTGGGGCGGCTGCAGTGACGG - Intergenic
1027162302 7:75811714-75811736 GCCTGGAGAAGCCACAGTGATGG - Exonic
1029390519 7:100271532-100271554 GGCTGGGGCGGCTGCAGTGACGG - Intronic
1031886613 7:127251726-127251748 GGCTGGCGCGGCCCCAGTTTCGG - Intronic
1032549400 7:132770668-132770690 GGCTGTCTGGGCCAAATTGATGG + Intergenic
1034349315 7:150405960-150405982 TGCAGGCGGGGCCTCAGTCAGGG + Intronic
1034396328 7:150828099-150828121 GTCTGGCTGGGCCAAAGTCAAGG + Intronic
1035105692 7:156440269-156440291 CTCTGGCGGGGCCAGAGTGGAGG - Intergenic
1038004446 8:23417863-23417885 TGTTGGAGGGGCCACAGGGATGG - Intronic
1042693373 8:71528514-71528536 GGCTGGCTTGGGCACAGTAAAGG - Intronic
1046002899 8:108443376-108443398 TGCTGGCGGGGCTACGGTGCTGG - Intergenic
1046958904 8:120089147-120089169 GCCTGGAGAGGCCACAGTGCAGG + Intronic
1047382531 8:124376480-124376502 GGCTGGAGGGGCTACAGAAATGG + Intergenic
1049180851 8:141221431-141221453 GGCTGCCGGGGCCACCCTGGCGG - Intronic
1049342329 8:142119816-142119838 GTCTAGCGGGGTCACAGAGATGG - Intergenic
1052996066 9:34552193-34552215 GGCAGCCAGGGCCAGAGTGATGG + Exonic
1053802866 9:41775194-41775216 GGCTGGTGGGGCCACAGGACTGG + Intergenic
1054142380 9:61539876-61539898 GGCTGGTGGGGCCACAGGACTGG - Intergenic
1054191171 9:61986540-61986562 GGCTGGTGGGGCCACAGGACTGG + Intergenic
1054462124 9:65471026-65471048 GGCTGGTGGGGCCACAGGACTGG - Intergenic
1054647198 9:67601177-67601199 GGCTGGTGGGGCCACAGGACTGG - Intergenic
1055664359 9:78538667-78538689 GGCTGGCGAGGCCACAATCATGG - Intergenic
1057176281 9:93002771-93002793 GGCAGGAGGGGCCACTGTGATGG - Intronic
1057868784 9:98702300-98702322 GGCAGGAGGGGCAACAGAGAGGG - Intronic
1057933597 9:99217999-99218021 GGCTGGAAGAGCCAGAGTGAAGG - Exonic
1059320974 9:113469247-113469269 AGCTGGCAGGGACACATTGAAGG - Intronic
1060526158 9:124322463-124322485 GGACGGCGGGGACTCAGTGAGGG - Intronic
1060764169 9:126281531-126281553 GGAAGTCGGGGCCACAGTTAGGG - Intergenic
1060936421 9:127518712-127518734 GGCTCCCTGGGCCACAGTGTAGG + Intronic
1061257056 9:129459414-129459436 GGCTGGCGGGTCCCCAGGGCCGG + Intergenic
1061461596 9:130743924-130743946 GTCTGGAGTGGCCACATTGAGGG + Intronic
1061537618 9:131259547-131259569 GGCTCTGGGTGCCACAGTGATGG - Exonic
1061606996 9:131718243-131718265 GTGTGGCTGGGACACAGTGACGG + Intronic
1061990930 9:134158377-134158399 AGCTGGCGGGGCCACGGTGGCGG - Exonic
1062249652 9:135587770-135587792 GGCCGGCCGGGACACAGAGAAGG + Intergenic
1190273426 X:48884696-48884718 GGCTGGCGGGGAAAGAGGGAGGG + Intergenic
1192195497 X:69025125-69025147 GGTGGGCGGGGCCAGAGTGAAGG + Intergenic
1192231672 X:69269534-69269556 TGCTGGCTGGGCCCCAGTGGAGG + Intergenic
1192502323 X:71662279-71662301 GGGTGGCGGAGCCAAAGGGAAGG - Intergenic
1196798931 X:119524828-119524850 TGGTGGTGGGGCCAGAGTGAGGG - Intergenic
1196871370 X:120116133-120116155 GGGTGGGGGGTGCACAGTGAGGG + Intergenic
1199540957 X:148957369-148957391 GGATGGCCTGGCCACAGTGGGGG - Intronic
1199810777 X:151346537-151346559 GGCTGGAGCAGCTACAGTGAAGG + Intergenic
1199991264 X:152988942-152988964 GGTGGGGGGGGCCACACTGAGGG - Exonic