ID: 1122617952

View in Genome Browser
Species Human (GRCh38)
Location 14:103033840-103033862
Sequence CCAGTGAGGAAACTGCTGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 315
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 278}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122617952_1122617956 -6 Left 1122617952 14:103033840-103033862 CCACACAGCAGTTTCCTCACTGG 0: 1
1: 0
2: 2
3: 34
4: 278
Right 1122617956 14:103033857-103033879 CACTGGAAGTGCATTGCGGCAGG 0: 1
1: 0
2: 0
3: 4
4: 58
1122617952_1122617957 14 Left 1122617952 14:103033840-103033862 CCACACAGCAGTTTCCTCACTGG 0: 1
1: 0
2: 2
3: 34
4: 278
Right 1122617957 14:103033877-103033899 AGGAAAATCAGCCCCACGCCTGG 0: 1
1: 0
2: 1
3: 15
4: 186
1122617952_1122617954 -10 Left 1122617952 14:103033840-103033862 CCACACAGCAGTTTCCTCACTGG 0: 1
1: 0
2: 2
3: 34
4: 278
Right 1122617954 14:103033853-103033875 TCCTCACTGGAAGTGCATTGCGG 0: 1
1: 0
2: 0
3: 14
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122617952 Original CRISPR CCAGTGAGGAAACTGCTGTG TGG (reversed) Intronic
900160930 1:1223497-1223519 CAGGTGAGGAAACGGGTGTGGGG - Intronic
900199535 1:1398013-1398035 CCAGTGAGGACAGTGCGCTGTGG - Intronic
900200087 1:1400691-1400713 CCAATGAGAAACCAGCTGTGTGG - Exonic
900463267 1:2811342-2811364 CCAGTGGGGAAACAGCCATGGGG + Intergenic
900694675 1:4002374-4002396 CCTGAGAGGCAACTGCTCTGTGG + Intergenic
901039472 1:6355299-6355321 CGTGTGTGGAAACAGCTGTGGGG - Intronic
902137655 1:14324203-14324225 CCAGAGAGGAAACTGTAGTCAGG - Intergenic
904450767 1:30609837-30609859 GCTGTGAGGGAGCTGCTGTGGGG + Intergenic
905509743 1:38509585-38509607 CTAGTGGCGAAACTGCAGTGAGG - Intergenic
907863116 1:58372676-58372698 CGAGGGAGGAACCTGGTGTGGGG + Intronic
909379524 1:74982370-74982392 CAAGGGAGGAAACTGGTGGGAGG + Intergenic
910371650 1:86523330-86523352 CCAGCGAGGAACCCGCTGGGAGG - Intergenic
912753952 1:112308886-112308908 CTAATGAGGGAACAGCTGTGGGG + Intergenic
914512045 1:148342640-148342662 ACAGTGAAGAAAATGCTTTGGGG - Intergenic
915982264 1:160427712-160427734 ACAGTGGGGAAACTGCTCAGAGG - Exonic
917788897 1:178487061-178487083 CCAGAGAGAAGACTTCTGTGGGG + Intergenic
917869203 1:179227361-179227383 CTAGTGAGGAGACAGCTGTCAGG - Intronic
919006653 1:191908170-191908192 CCTGGGAGGAAACTGGTGGGAGG - Intergenic
919028174 1:192203689-192203711 TCAGGGAGGAAACTGGTGGGAGG - Intergenic
920242802 1:204565860-204565882 CCAGTGAGATAACGCCTGTGAGG + Intergenic
920350619 1:205335747-205335769 CTAGTGAGGAGACTGCAGAGAGG - Intergenic
921933039 1:220770820-220770842 CCTGAGAGGAAACTGGTATGTGG + Intronic
923775158 1:236971443-236971465 CCAGTTAGGAGACTGTTGTGCGG - Intergenic
923968598 1:239173284-239173306 CAAGGGAGGAACCTGGTGTGAGG + Intergenic
1064579345 10:16778367-16778389 GCAGAGAGGAAACTGCTGGCTGG - Intronic
1065996469 10:31064021-31064043 CAAGGGAGGACAATGCTGTGGGG - Intergenic
1067067882 10:43113751-43113773 CAAGGGAGGAAATTGCTGGGAGG + Intronic
1067780081 10:49195603-49195625 ACAGTGAGGAAAATACTGTATGG - Intergenic
1069610025 10:69766723-69766745 CCAGTGTTGAGTCTGCTGTGTGG + Intergenic
1070900929 10:80028519-80028541 GCAGTGGGGAGCCTGCTGTGGGG - Intergenic
1070902665 10:80044286-80044308 GCAGTGGGGAGCCTGCTGTGGGG - Intergenic
1072089645 10:92115077-92115099 CCAGTGTGGAAAGAGCTGCGGGG + Intronic
1073205841 10:101768906-101768928 GCACTCAGGAAACTGCCGTGGGG + Intergenic
1077186474 11:1237571-1237593 CCAGTCAGGAAACTGCTTTTTGG - Intronic
1078077769 11:8177137-8177159 CCTGTCAGGAAACTGCGTTGTGG - Intergenic
1078348366 11:10571842-10571864 CAGGTGAGGAAACAGCTTTGAGG - Intronic
1079010012 11:16820331-16820353 CCACTTAGAAAATTGCTGTGAGG + Intronic
1080451312 11:32381147-32381169 CCAGAGAGGAAGGTGCTGTTAGG - Intergenic
1080897509 11:36458870-36458892 CCAGGCAGGACAATGCTGTGGGG - Intronic
1085326511 11:75610706-75610728 CCAGGCAGGAGACTGCTGTTAGG + Intronic
1085344293 11:75757694-75757716 ACAGTGTTCAAACTGCTGTGGGG + Intergenic
1085817227 11:79752097-79752119 CCAGGGAGGCAACTGGTGAGAGG + Intergenic
1087483951 11:98737309-98737331 CCAGTGAGTAATCTGCTGCCAGG - Intergenic
1087731130 11:101779701-101779723 CCAGTGGGGACTCTGCTGGGGGG - Intronic
1088379328 11:109175867-109175889 CCAGTGATGAAGTTGCTGTAGGG - Intergenic
1089700738 11:120242339-120242361 CCAGTGCGCACCCTGCTGTGGGG + Intronic
1090743419 11:129687612-129687634 TCAGAGAGGAAAATGCAGTGGGG + Intergenic
1090849403 11:130558955-130558977 CCAGTTAGAAAACTGTTGTTTGG - Intergenic
1091066535 11:132518701-132518723 ACAGTGTGGTAGCTGCTGTGAGG - Intronic
1092774396 12:11929730-11929752 CCAGTGACGAAACTGCCTGGGGG - Intergenic
1095731713 12:45512796-45512818 CCACTGAGGAACCTGATGGGAGG - Intergenic
1097156428 12:57015594-57015616 GTAGTGAGGAAACTGGGGTGGGG - Intronic
1099838023 12:87932596-87932618 CTAAAAAGGAAACTGCTGTGTGG + Intergenic
1103005139 12:117414890-117414912 CCATGGAGGAACCTGCTGTGTGG - Intronic
1104294071 12:127495861-127495883 CCAGTGAGAAATGTCCTGTGAGG - Intergenic
1104798626 12:131537617-131537639 CCTGTGAGGAAACTGGTTTCCGG + Intergenic
1105341233 13:19528017-19528039 ACAGTGTGGAAACTGCAGTGTGG + Intronic
1105877673 13:24573339-24573361 ACAGTGTGGAAACTGCAGTGCGG - Intergenic
1106531798 13:30600121-30600143 CCAGTGAGGAAACTGTGATTAGG - Intronic
1106937114 13:34735139-34735161 AAAGTGAGGACACTCCTGTGTGG + Intergenic
1107071579 13:36275818-36275840 ACAGTCAGGAAAATGGTGTGGGG + Intronic
1108419908 13:50238086-50238108 CGGGTGAGGAAACTGGAGTGTGG + Intronic
1108635780 13:52333335-52333357 ACAGTGTGGCAACTGCAGTGTGG + Intergenic
1108652027 13:52489913-52489935 ACAGTGTGGCAACTGCAGTGTGG - Intergenic
1109879445 13:68451563-68451585 CCTGGGAGGAAACTGGTGGGAGG + Intergenic
1110242989 13:73289433-73289455 CCAGTGTGGAAACTTCTCTCAGG + Intergenic
1110452165 13:75648874-75648896 TCAGGGAGGAAACAGCTATGGGG + Intronic
1110946965 13:81433973-81433995 TTAGGGAGGAAACTGCTGGGAGG - Intergenic
1113098138 13:106688185-106688207 AGAGTGAGGAAATTGGTGTGAGG + Intergenic
1113119841 13:106914431-106914453 CAAGTGAGGAAACTGAGGTTTGG + Intergenic
1114902307 14:27078553-27078575 CCAATGAGAAAACTGCAGAGCGG + Intergenic
1116067939 14:40008061-40008083 CCAGTCAGGAAACCAGTGTGGGG - Intergenic
1116414930 14:44668205-44668227 CCAGTGAGGGAGCTAATGTGGGG - Intergenic
1116508679 14:45716777-45716799 CGCGTGAGCAAACTTCTGTGTGG + Intergenic
1117512751 14:56470283-56470305 AGAGTGAGGAACCTACTGTGAGG - Intergenic
1119712202 14:76830344-76830366 CTAATGAGGACACAGCTGTGGGG + Intronic
1120451298 14:84670151-84670173 CACGTGAGGAAACTCTTGTGAGG + Intergenic
1120872804 14:89353127-89353149 CCACTCAGGAAACGTCTGTGTGG - Intronic
1120937085 14:89908015-89908037 CCAGTGAGTAAATAGATGTGAGG - Intronic
1120959459 14:90111222-90111244 CAAGTCAAGAAACTGCTCTGGGG + Intronic
1121641850 14:95490001-95490023 CCATTGAGGAAACTGGGGTTTGG - Intergenic
1122094969 14:99363959-99363981 CCAGTGGGGACACAGCTGAGCGG + Intergenic
1122617952 14:103033840-103033862 CCAGTGAGGAAACTGCTGTGTGG - Intronic
1123026396 14:105426221-105426243 CCTGTGACGACGCTGCTGTGAGG - Intronic
1125769042 15:42153074-42153096 CAAGTGAGTAACGTGCTGTGTGG + Intronic
1126611960 15:50538756-50538778 CCAAGCAAGAAACTGCTGTGAGG - Exonic
1127926329 15:63547095-63547117 CTAGAGAGGAATGTGCTGTGAGG + Intronic
1128215695 15:65932723-65932745 CCACTTAGGAACCTACTGTGGGG + Intronic
1128784908 15:70387671-70387693 CCAGTGAGGAAACTTGTGTCTGG + Intergenic
1129106787 15:73315246-73315268 TCAGTGAGGAAAATGCTGCCTGG + Intergenic
1131271626 15:90950670-90950692 CCAATGTGTAAACTGCTGTGGGG - Intronic
1132087952 15:98923316-98923338 CCTGTGAGGAAGCTGCTAGGAGG - Intronic
1133576585 16:7097201-7097223 AGAGTTAGGAAACTGCTATGAGG + Intronic
1133622234 16:7537404-7537426 ACAGTGAGGAAACTGAGGCGTGG + Intronic
1134038692 16:11051468-11051490 CAAGTAAGGAATCTGCTTTGAGG + Intronic
1134404834 16:13947318-13947340 TCAGTGAGGAAACTACAGAGGGG + Intronic
1134861449 16:17564075-17564097 TCAGTGGGATAACTGCTGTGTGG - Intergenic
1138577052 16:57914739-57914761 CCAGTGATGAAACGGGTGTCTGG + Intronic
1138614627 16:58155282-58155304 CCAGTGAGGGAAGGGCTGGGAGG + Intergenic
1138708051 16:58937985-58938007 CGAGGGAGGGAACTGCTGGGAGG - Intergenic
1139691657 16:68645553-68645575 CCCGTGAGGACCCTGCGGTGTGG + Intronic
1140606820 16:76549089-76549111 CCAGTGAGGAGGCTCTTGTGGGG + Intronic
1142299193 16:89246997-89247019 CCAGCGTGGAAACTGCAGAGGGG - Intergenic
1143329462 17:6122531-6122553 GCAGTGTGGAAACTCCTGAGGGG - Exonic
1143748318 17:9009919-9009941 CGAGTGAGGAAACTGACGTCAGG - Intergenic
1144788734 17:17845967-17845989 CCAGAGAGGAAACCTCTGTCTGG - Intronic
1146179101 17:30685895-30685917 CAATTGTGGAAACTGCTCTGAGG - Intergenic
1146767309 17:35535071-35535093 CCAATGAGGAAACTGAGGTTGGG + Intronic
1148879218 17:50712854-50712876 CCAGGGAGGAAGCTGGTGGGAGG - Intergenic
1149398698 17:56271613-56271635 CCATTGAGTCAGCTGCTGTGAGG + Intronic
1150532190 17:65995562-65995584 CCACTGAGGGAAGTGCTGGGTGG - Intronic
1150819138 17:68420952-68420974 CCAGTGAGTACACTGGTTTGTGG - Exonic
1151298561 17:73204326-73204348 CAAGTGAGGAAACCACTGAGCGG - Intronic
1151990767 17:77572582-77572604 CCACTGAGGAAACAGCAGGGAGG - Intergenic
1152920044 17:83062077-83062099 CCAGAGGGGAGACTGCTGGGTGG - Intergenic
1154193415 18:12248800-12248822 GCAGTCAGGAAACTTGTGTGAGG - Intergenic
1154373224 18:13785542-13785564 CCAGAGAGGAGACTGCTGCACGG - Intergenic
1157583934 18:48789310-48789332 CCAGTGAGGAAACTGAGGCTTGG - Intronic
1159866834 18:73715695-73715717 CCAGTGAGGAAGATGGAGTGAGG + Intergenic
1160404952 18:78639023-78639045 CCAGTCCAGAAAATGCTGTGTGG - Intergenic
1160536047 18:79592946-79592968 CCAGGGAGGGACCTGCTGGGAGG - Intergenic
1161733283 19:5975471-5975493 CCAGTGAGGACCCTGTTGTGAGG - Intronic
1162979521 19:14229679-14229701 CAATTGTGGAAACTGCTCTGAGG + Intergenic
1164462378 19:28459990-28460012 CCAGTGAGGAAGCTGTGGGGAGG + Intergenic
1164478979 19:28597131-28597153 CCAGTGAGGAAACTGAGATTCGG - Intergenic
1164793887 19:31010822-31010844 CCAGTGAGAAAACGGCTCTTTGG - Intergenic
1164815950 19:31203631-31203653 CCAGTGAAGAAACAGCTCTGGGG + Intergenic
1166895367 19:46019051-46019073 CCAGTGAGGAGAGTGCTGGGAGG + Intronic
1168168362 19:54570607-54570629 CAAGTGAGGGAACCACTGTGGGG - Intergenic
926008790 2:9392693-9392715 ACAGAGAGGAAACTGGCGTGGGG - Intronic
927066931 2:19481000-19481022 GGAGTGAGGAAACTTCTGTGGGG - Intergenic
928910375 2:36415033-36415055 CCAGCCAGGAGACTGCTATGTGG + Intronic
929531673 2:42756606-42756628 CTAGAGAGGAAACGGCTTTGGGG + Exonic
929799122 2:45084216-45084238 CCACTGTGGAAACATCTGTGGGG + Intergenic
931696712 2:64876429-64876451 CCAGGCAGGAAAATACTGTGAGG - Intergenic
934903634 2:98180490-98180512 CCAGTGAGAAAAGTTATGTGAGG - Intronic
935315690 2:101831495-101831517 CCAGTCTGGAAGCTTCTGTGAGG - Intronic
935425248 2:102912458-102912480 CCAGTCAGGGAGCTGATGTGGGG + Intergenic
935959431 2:108410106-108410128 ACAGTGAGAAAACTGGAGTGGGG - Intergenic
937127725 2:119484951-119484973 CCAGAGGAGAAACAGCTGTGGGG + Intronic
937257708 2:120566598-120566620 GCAGTGGGGAAACTGAGGTGGGG - Intergenic
938085204 2:128395380-128395402 CCCCAGAGGAAGCTGCTGTGGGG + Intergenic
938108505 2:128549290-128549312 ACAGTGAGGAAACTGGGCTGAGG - Intergenic
941202993 2:162537954-162537976 AGTGTGAGGAAACTGCTTTGAGG - Intronic
941548727 2:166888024-166888046 CAAGTGAGGAAACTAATGTTTGG + Intergenic
941999207 2:171629229-171629251 CTAGTGAGGAAACTACAGAGAGG + Intergenic
942481337 2:176391728-176391750 CAAGTGAGGAAACTGAGGTATGG + Intergenic
947084325 2:226434178-226434200 CCAGTCAGGAAACTAGTGAGAGG + Intergenic
947142983 2:227036754-227036776 CCAGTGTGGTAAGTGCTGTGGGG + Intronic
948116656 2:235498422-235498444 CCAGAGACGACACAGCTGTGTGG - Intronic
948800926 2:240433236-240433258 CAAGTGAGGAAACACCTGAGAGG - Intergenic
949034667 2:241810981-241811003 CCAGTGAGGCCTGTGCTGTGAGG + Exonic
1168913740 20:1469608-1469630 CCAGTGAGGACACGGCAGAGGGG - Intronic
1169463515 20:5817848-5817870 TTGCTGAGGAAACTGCTGTGAGG + Intronic
1169902517 20:10567809-10567831 CCAGTGAGCAGACTGTTGAGTGG - Intronic
1171431874 20:25088016-25088038 CCATTGAGGAAACTGCAGTAGGG - Intergenic
1172775180 20:37403115-37403137 CCGGTGAGGAAAGTGGGGTGGGG - Intronic
1173517740 20:43677213-43677235 CCAGAGAGAAATCTGCTCTGGGG - Intronic
1173827852 20:46058707-46058729 CCAGGGAGGAAACTCCGGGGAGG - Intronic
1174609069 20:51784295-51784317 GAAGTGAGGAAACTGGTGTTTGG + Exonic
1174897469 20:54466171-54466193 CCAGTTAGGAAGCTACTGAGGGG - Intergenic
1174931955 20:54826041-54826063 TCAGTGAGGAAAATGGTTTGTGG - Intergenic
1175271449 20:57736868-57736890 CCAGAGAGGGAGCTGCTGTGGGG - Intergenic
1177469901 21:21547463-21547485 GCAGTGAGAAAATTGCTGTTAGG - Intergenic
1177830894 21:26137565-26137587 CCAGTGAGGAAAGAGCTCTCTGG - Intronic
1178728678 21:35078946-35078968 CCAGGCAGGAACCTGCTGAGGGG - Intronic
1179254141 21:39700253-39700275 TCAGTTAGGAAACTGTAGTGTGG - Intergenic
1179445105 21:41425652-41425674 CCAGGGTGGAAACGGGTGTGTGG - Intronic
1181764366 22:25080500-25080522 ACAGTGAGGAAGGTGCTGAGAGG - Intronic
950170822 3:10838054-10838076 CCACTGAGGAAAGTGCTGCCAGG - Intronic
951961506 3:28328992-28329014 CCAGTTGGGGAACTGCGGTGAGG - Intronic
952948997 3:38503115-38503137 TCAGTGAGGAAATTACAGTGAGG + Intronic
953351591 3:42220387-42220409 CCACAGAGGAAACAGCTGAGGGG - Intronic
953380114 3:42463876-42463898 CCAGAGATGAATCTGCTGAGAGG + Intergenic
953917819 3:46931726-46931748 CCAGAGAGAGAACTGCTGTGAGG + Intronic
954018263 3:47714986-47715008 CAAGTGAGGGAAATGCTTTGAGG - Intronic
954855245 3:53638641-53638663 ACAGTGAAGAAGCTGCAGTGAGG + Intronic
956340477 3:68217641-68217663 TAATAGAGGAAACTGCTGTGTGG + Intronic
958157290 3:89771284-89771306 CCAGTGTGGACTCGGCTGTGGGG + Intergenic
960463305 3:117964026-117964048 CCAGGGAGGGACCTGCTGGGAGG + Intergenic
961191967 3:124969560-124969582 CCGGTGAGCAAACTCATGTGTGG + Exonic
961753539 3:129112489-129112511 ACAGTGAGGAAACTGATGCAAGG + Intronic
962847223 3:139283365-139283387 ACAGTGAGGAAAGTACAGTGTGG - Intronic
963604073 3:147399161-147399183 CTAGTCACAAAACTGCTGTGTGG - Intronic
965224593 3:165972156-165972178 CCAGTGAGGACTCTGCTGTGGGG - Intergenic
966129527 3:176621685-176621707 GCAATGGGGAAACGGCTGTGTGG + Intergenic
967077720 3:186019531-186019553 CCAGTAATGAAATTGCTGGGTGG - Intergenic
967537921 3:190628202-190628224 GCAGTGAGCCAACTGCTGTTCGG - Intronic
968446760 4:656030-656052 CCAGTGAGGGCAAGGCTGTGGGG - Intronic
969345651 4:6568275-6568297 CCAGTGATGAATCTGGTGGGCGG - Intergenic
970047968 4:11877273-11877295 CCAGGGAGGGACCTGCTGGGAGG - Intergenic
972944213 4:44234159-44234181 CAAGTTAGGAAACTGAGGTGGGG + Intronic
973743828 4:53944394-53944416 CTACTGAGGAGACTGCTGTCCGG - Intronic
974017309 4:56659341-56659363 TAAGTGAGGAAAATGATGTGTGG + Intronic
975698244 4:77035948-77035970 CCAGTGAGGAAAATGCAGAGGGG - Exonic
975774984 4:77776691-77776713 CCATTCACGAAACTGCTGTGTGG - Intronic
978211293 4:106139141-106139163 CTAGTGAGGAGAGTGATGTGGGG - Intronic
979715917 4:123837639-123837661 CCATTGCTGAAACTGGTGTGGGG + Intergenic
981187959 4:141827537-141827559 CCAGTGAGTTAACTGATGGGTGG + Intergenic
981281154 4:142960658-142960680 CCATTAAGCAAACTGCTGTTTGG + Intergenic
982178678 4:152730034-152730056 CAAGTGAGGAAACTACTGTAGGG + Intronic
985118180 4:186612894-186612916 CCAGTGAACCTACTGCTGTGAGG - Intronic
985492427 5:187514-187536 ACAGGGAAGAAACTGCTGGGTGG - Exonic
985855890 5:2426515-2426537 CCAGTGAGAAAACAGCCCTGAGG - Intergenic
986023870 5:3831465-3831487 CCAGTGAGGGACCTGGTGGGAGG + Intergenic
986516899 5:8573867-8573889 CCAGTGAGGAAGCAACTGAGTGG + Intergenic
988809508 5:34770573-34770595 CCATTCAGGAATCTGCTGAGAGG - Intronic
990950653 5:61294991-61295013 CCAGTGAGAAGCCTGCGGTGAGG + Intergenic
991569175 5:68036376-68036398 CCTCTTAGGAAGCTGCTGTGAGG + Intergenic
992739588 5:79759962-79759984 CAAGTGAGAAAACTAATGTGAGG + Intronic
992918871 5:81491549-81491571 CCTGTGAAGGAGCTGCTGTGAGG + Intronic
992919742 5:81502286-81502308 CAAATGAGGAAAATGCTTTGAGG - Intronic
994795789 5:104298107-104298129 CAAGTGAAGAAAGTGCTTTGAGG + Intergenic
994932569 5:106207773-106207795 CCAGTCAGAAAACTGCTCTGGGG - Intergenic
995189648 5:109307060-109307082 CCAATGAGGAAAGAGCTGAGGGG + Intergenic
995254597 5:110032108-110032130 ACAGAGAGGAGAATGCTGTGTGG - Intergenic
995255105 5:110036895-110036917 ACAGAGAGGAGAATGCTGTGTGG - Intergenic
995649661 5:114356018-114356040 CCAGTGAGGAAATGTCTGTGAGG + Intergenic
996401630 5:123069229-123069251 CCAGGGAGTAAACGGGTGTGTGG + Intergenic
997375182 5:133392606-133392628 CCAGTGCAGAAAATGCTCTGCGG + Intronic
998923627 5:147098534-147098556 CCAGGGAGGAAGCTACTGTTTGG - Intergenic
1000015077 5:157268746-157268768 CCAGTGAGGTGACTGATGTCTGG - Intronic
1000312561 5:160059336-160059358 TGAGTGAGGAAACTGCTTTAAGG - Intronic
1000367758 5:160506774-160506796 CCAGGCAGGAAACGGTTGTGGGG - Intergenic
1002885894 6:1293557-1293579 CCAGTGAGGAAACAGCTACTGGG + Intergenic
1003014026 6:2453455-2453477 CCATTGTGGATAGTGCTGTGTGG + Intergenic
1004147438 6:13081252-13081274 CGCATGAGGAAACTGCTGTAGGG - Intronic
1004842516 6:19603587-19603609 CCAATAATGGAACTGCTGTGAGG + Intergenic
1005229592 6:23684730-23684752 CCAGGGAGAAACCTGCTTTGGGG - Intergenic
1006080118 6:31560258-31560280 CCAGTGAGAAATCTCCTGGGTGG - Intergenic
1006262500 6:32887006-32887028 ACAGTGAGAAAAATGCTGTGGGG - Intergenic
1006386855 6:33735744-33735766 CCAGTGAGGAACCTGTTCTGGGG - Intronic
1006517108 6:34551238-34551260 CCACTAAGGCAACTGCTGTGGGG - Intronic
1007664428 6:43505965-43505987 CCACACAGGAAACAGCTGTGCGG - Exonic
1008103311 6:47416047-47416069 CCACTGAGGAAATAGCTCTGAGG + Intergenic
1008414034 6:51218427-51218449 CCAGTAAGGAAACTACTATTTGG + Intergenic
1010061268 6:71625622-71625644 CCACAGAGGGGACTGCTGTGTGG - Intergenic
1011338494 6:86286002-86286024 CCCTAGAGGAAACTCCTGTGGGG + Intergenic
1011752086 6:90463592-90463614 CCAGTGAGGAACAGGATGTGTGG + Intergenic
1013388393 6:109656491-109656513 CCAGTGAGGAAATTCCTTTATGG - Intronic
1014303723 6:119714739-119714761 TCAGTCAGGAAACCGATGTGAGG + Intergenic
1015703237 6:136058857-136058879 CCATTGAGGACACTGATTTGGGG + Intronic
1015936613 6:138411301-138411323 CCAGTCAGGAGGCTGCTGTGGGG - Intronic
1017359018 6:153543777-153543799 CCACTGAGGAAACACTTGTGAGG + Intergenic
1018314363 6:162542304-162542326 CCTGTGAGGTAACTACTGTATGG + Intronic
1018919780 6:168163587-168163609 GCACTGAGGAAGCTGCTCTGTGG + Intergenic
1019287836 7:232372-232394 CCAGGGAGGAGACGGCTCTGTGG - Intronic
1019983318 7:4637720-4637742 GCAGTGAGGATACTGCCGTGGGG - Intergenic
1021326298 7:19273402-19273424 CCAGTGGGGACTCTGCTGGGGGG + Intergenic
1022904228 7:34840383-34840405 CTAGGGAGGAAAACGCTGTGTGG + Intronic
1023356845 7:39375668-39375690 GCAGTGTGGAAACTCCTGGGAGG + Intronic
1023639720 7:42245361-42245383 CCTGTGAGGAAACTGCAGCTAGG - Intergenic
1024276188 7:47678986-47679008 CAAGGCAGAAAACTGCTGTGGGG + Intergenic
1024860614 7:53835568-53835590 CTAGAGAGCACACTGCTGTGAGG - Intergenic
1025639742 7:63354793-63354815 CCAGTCAGGAAACTGCCACGGGG + Intergenic
1025642957 7:63393299-63393321 CCAGTCAGGAAACTGCCACGGGG - Intergenic
1026941864 7:74291752-74291774 CCAGGGAGGAGGCTGCAGTGAGG - Intronic
1029315562 7:99710001-99710023 CAAGTGAGGACAGGGCTGTGTGG - Intronic
1029321281 7:99762792-99762814 CAAGTGAGGACAGGGCTGTGTGG - Intronic
1031538019 7:122959141-122959163 TGAGTCAGGAAACTGCTTTGAGG + Intergenic
1033545080 7:142392320-142392342 CAAGTCAGGGAACTGTTGTGCGG - Intergenic
1034276761 7:149827240-149827262 CCAGTGAGGAAACTGAGGTCTGG + Intergenic
1034671438 7:152861929-152861951 CGACTGAGGAAGCTGATGTGAGG + Intergenic
1035534780 8:382588-382610 TCCCTGAGGAAACTGCAGTGAGG + Intergenic
1035728560 8:1839666-1839688 CTGGTGTGGAAACTGGTGTGGGG + Intronic
1036225210 8:6952042-6952064 GCGGTGAGGAATCTGCTGTAGGG + Intergenic
1036494918 8:9261521-9261543 CCAGTGAAGAAAATAATGTGAGG - Intergenic
1038351828 8:26783043-26783065 CCAGTTAGAAAACTGATATGAGG - Intronic
1039356305 8:36820411-36820433 GCAATGAGGAAATTGCTGTAGGG + Intronic
1039836866 8:41263533-41263555 CCAGTGAGGATGCTGCAGTGAGG - Exonic
1040555777 8:48476404-48476426 CCAGTGGGGAAACTGTGGTGTGG - Intergenic
1042493961 8:69435341-69435363 CAAGGGAGGAAACTGGTGGGAGG - Intergenic
1042580480 8:70272525-70272547 TCAGTTAAGAGACTGCTGTGGGG - Intronic
1044998288 8:97857966-97857988 CCAATTAGGAAACTGCAATGTGG - Intergenic
1045653944 8:104367694-104367716 CCAGCGAGGAACCTGCGGTCCGG + Intronic
1046453491 8:114425381-114425403 CCAGTGAGCACTGTGCTGTGGGG + Intergenic
1047605354 8:126468782-126468804 CTAGTGAGGTGACTGGTGTGGGG - Intergenic
1048266411 8:132991241-132991263 CCACTGTGGAGAGTGCTGTGGGG - Intronic
1048444707 8:134484679-134484701 CCAGTAACCAAAGTGCTGTGTGG - Intronic
1048948889 8:139476351-139476373 ACAGTGAGGAAGCTGCTGAGAGG + Intergenic
1049246062 8:141563224-141563246 GCAGTGAGGAAACTGAGGTAGGG - Intergenic
1050139364 9:2501647-2501669 CCTGGGAGGAAACTGAAGTGAGG - Intergenic
1050579254 9:7033574-7033596 CCTGTTAGGGAACTGCTGAGTGG + Intronic
1050935198 9:11387140-11387162 CCAGGCAGAAAACTGCTGCGGGG + Intergenic
1051528400 9:18073261-18073283 CCTGTGAGGAGAAGGCTGTGTGG + Intergenic
1052476695 9:28970253-28970275 CAAGTGAAGAAACTGCTTTTAGG + Intergenic
1053005694 9:34602849-34602871 GCAGTGAGAAAGCTGCTGTAGGG - Intergenic
1053274966 9:36776367-36776389 ACAGTGGGGATACTGTTGTGAGG - Intergenic
1056360825 9:85855797-85855819 CAAGTGAGGGACCTGCTGGGAGG + Intergenic
1056937184 9:90924808-90924830 GCAGTGAGGGAAGTGCTGTGGGG + Intergenic
1057689245 9:97268670-97268692 ACAGTGTGGCAACTGCAGTGTGG - Intergenic
1057726452 9:97571963-97571985 CCAGTGAGGAAACTTCTGGAGGG - Intronic
1060738636 9:126082817-126082839 GCAGTGTGGGAACTGCAGTGAGG + Intergenic
1061419705 9:130466586-130466608 CCAGAGAGGATGCTGTTGTGAGG - Intronic
1061995746 9:134181867-134181889 TCATTCAGGAAACTGCCGTGGGG + Intergenic
1062695705 9:137875305-137875327 CCTCTGTGGAAACTGCTGTCCGG + Intergenic
1186006133 X:5074534-5074556 CCAGAGAGGAACCTGATGGGAGG + Intergenic
1187360982 X:18627545-18627567 CCAGTGAGCAGACGGCTCTGAGG + Intronic
1188606697 X:32040399-32040421 ACAGAGTGGAAACTGCTTTGGGG - Intronic
1188662319 X:32775324-32775346 CCAGTGAGGACTCTGTGGTGGGG + Intronic
1188865282 X:35306191-35306213 CTAGTGAGGACACTGTGGTGTGG - Intergenic
1190456054 X:50628736-50628758 CCAGATAGGAAACTGAGGTGAGG - Intronic
1190658607 X:52634754-52634776 GCAGAGAGGAAACAGTTGTGGGG + Intergenic
1191687992 X:63912461-63912483 CAAGTGAGGAAGCTCTTGTGGGG - Intergenic
1192743212 X:73913450-73913472 CCAGTGAAGAAATTGCTGTGGGG + Intergenic
1195211557 X:102655496-102655518 CCAGTGTGGAATCTGGTGTTGGG + Exonic
1195670985 X:107469821-107469843 CCAAAGAGGAAACTGGTATGAGG + Intergenic
1196000731 X:110782775-110782797 CAAATGAGGAAAGTGCTGTTAGG - Intronic
1196688552 X:118533540-118533562 CCAGTGTGGAAAATGATGTGTGG + Intronic
1197330880 X:125152925-125152947 CCAGTGAGAAAACTGCAGTTGGG - Intergenic
1197380149 X:125729054-125729076 CCAGTCAGGAAACCAGTGTGGGG + Intergenic
1198251086 X:134879924-134879946 CCAGTGAATAAACTGGTGGGGGG - Intergenic
1199495267 X:148445829-148445851 CAAGAGAGGCATCTGCTGTGAGG - Intergenic
1199848398 X:151708066-151708088 GCAGGGAAGAAACTGCTTTGGGG - Intergenic
1202590944 Y:26482554-26482576 ACAGTGTGGAAACTGCAGTGTGG - Intergenic