ID: 1122620058

View in Genome Browser
Species Human (GRCh38)
Location 14:103051197-103051219
Sequence CACTTCTGATTTTAGATTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 829
Summary {0: 1, 1: 0, 2: 5, 3: 72, 4: 751}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122620058 Original CRISPR CACTTCTGATTTTAGATTTA AGG Intronic
900878359 1:5362515-5362537 CATTTCAGATTTTGGATTTTTGG + Intergenic
901752906 1:11422557-11422579 CACACCTTATTTTAGATATATGG - Intergenic
902080457 1:13817093-13817115 CATTTCAGATTTTGGATTTTTGG - Intronic
902812579 1:18897086-18897108 CATTTCGGATTTTGGATTTTTGG - Intronic
904243189 1:29164899-29164921 CATTTCAGATTTTGGATTTTCGG - Intronic
904509814 1:30995017-30995039 CACTTCTGATTTTTGAATATGGG - Intronic
905722112 1:40213251-40213273 CACTTCTGATCTTACTTTCATGG + Intronic
906297358 1:44657185-44657207 CCCACCTGATTTTAGATTCAAGG - Intronic
906351352 1:45062825-45062847 CAACTCTTATTTTAGATTCAGGG + Intronic
906415133 1:45615826-45615848 CATTTCAGATTTTAGATTAAGGG - Intronic
906610407 1:47197902-47197924 CATTTCGGATTTCAGATTTTTGG + Intergenic
906718933 1:47991885-47991907 CATTTCTGATTTTGAATTTTTGG + Intronic
906911236 1:49953645-49953667 CATTTCAGATTTCAGATTTTTGG + Intronic
906995883 1:50793868-50793890 CATTTCAGATTTCAGACTTATGG - Intronic
907000915 1:50854834-50854856 CACTTTGGATTTTGGATTTTTGG - Intronic
907000933 1:50855032-50855054 CATTTTGGATTTTAGATTTTTGG + Intronic
907349499 1:53815116-53815138 CCCTTCTGATTTTGGTATTAGGG - Intronic
907534284 1:55135337-55135359 CATTTCAGATTTTTGAATTAGGG - Intronic
907858875 1:58331229-58331251 CACTTCTAATTCTAGTTTTCTGG - Intronic
908024495 1:59936332-59936354 CACTCCTGATTTTATAGTTTAGG - Intergenic
908027436 1:59967835-59967857 TGATTCTGATTTCAGATTTAAGG - Intergenic
908472656 1:64459299-64459321 CAACTTTTATTTTAGATTTAGGG + Intergenic
908578657 1:65489847-65489869 CACTTGTGAGTTCAGTTTTATGG + Intronic
909281166 1:73755676-73755698 CACTTCTGACATTAGATGTTGGG + Intergenic
909738396 1:78996463-78996485 CACTTCTCAGTTTATGTTTAAGG - Intronic
909803589 1:79846616-79846638 AACTTCTACTTTTAGCTTTAAGG + Intergenic
909887442 1:80960000-80960022 CACTTCTTAATTTTGATTCAGGG + Intergenic
909903197 1:81163606-81163628 CACTTCTGATTTTATTTATTTGG - Intergenic
910071957 1:83227139-83227161 CACTTTGGATTTCAGATTTTTGG - Intergenic
911001640 1:93171723-93171745 CTTTTCTGGTTTTAGAATTAGGG - Intronic
911393614 1:97277346-97277368 CAACTCTCATTTTAGATTCAAGG - Intronic
911413864 1:97546016-97546038 CACCTGTGATTTTATATTCATGG - Intronic
911640417 1:100282648-100282670 TATTTCAGATTTTAGATTTTTGG - Intronic
911719684 1:101177453-101177475 CATTTCTGTTTTAATATTTAGGG - Intergenic
912215868 1:107611134-107611156 CACATACGATTTTAGATTTTTGG - Intronic
913178282 1:116295358-116295380 CAATTTTTATTTTAGATTTGGGG - Intergenic
915151139 1:153832654-153832676 TAATTTTTATTTTAGATTTAAGG + Intronic
915386730 1:155501203-155501225 CATTTCTGATTTTAAAAATAAGG - Intronic
915817095 1:158979735-158979757 CAACTTTTATTTTAGATTTAGGG + Intergenic
916148661 1:161764504-161764526 CACTTTTATTTTTAGTTTTACGG - Intergenic
916251321 1:162741347-162741369 CATTTCGGATTTTGGATTTGTGG - Intronic
916307816 1:163359170-163359192 TACATCTGATTTTAGTTTAACGG + Intergenic
916385222 1:164259617-164259639 AACTTCTGATTTTAGTGTAAAGG + Intergenic
916516121 1:165518166-165518188 CAAATTTGATTTTAGATTCAGGG + Intergenic
916879219 1:169002982-169003004 CATTTATGATTTTGGATTTTTGG - Intergenic
916956240 1:169838791-169838813 CAACTTTTATTTTAGATTTAGGG + Intronic
917438449 1:175044658-175044680 AAATTCTGTTTATAGATTTAAGG + Intergenic
917745872 1:178006470-178006492 CATTTCAGATTTTGGATTTTTGG - Intergenic
917820213 1:178755189-178755211 CAGTTTTTATTTTAGATTCATGG + Intronic
917887566 1:179401512-179401534 CATTTCTGAATTTAGATCTTAGG - Intronic
918280147 1:182996354-182996376 CAACTTTTATTTTAGATTTAGGG + Intergenic
918956104 1:191209823-191209845 TACTTCTGATTATAGTATTATGG + Intergenic
919444533 1:197685740-197685762 GACTTCAGATTTTAAATTTTGGG - Intronic
920943776 1:210509336-210509358 CATTTCAGATTTCAGATTTTTGG + Intronic
921693069 1:218175373-218175395 CACTTCTGAAATTGGATTTGTGG + Intergenic
922145967 1:222944864-222944886 CACTTCTGATTAAAGAGTCAGGG + Intronic
922249049 1:223830309-223830331 CATTTCAGATTTCAGATTTTTGG + Intronic
922404190 1:225295116-225295138 CACTTCTGATTTTATTTATTTGG + Intronic
922625808 1:227041156-227041178 CAACTCTTATTTTAGATTTGTGG + Intronic
922912427 1:229229060-229229082 CATTTTTGATTTTGGATTTTCGG + Intergenic
923235873 1:232032162-232032184 CATTTCAGATTTTGGATTTGGGG + Intronic
923345847 1:233051830-233051852 CAATTTTCATTTTAGATTTGGGG - Intronic
923379826 1:233405806-233405828 TATTACTGATTTTAGATTCATGG - Intergenic
1063115991 10:3072240-3072262 CACTTCTGACTTCGGTTTTAAGG - Intronic
1063245990 10:4219148-4219170 CAATTTTTATTTTAGATTCAAGG + Intergenic
1063637916 10:7801831-7801853 CACTTCAGATTTTGGACTTTGGG + Intronic
1063838350 10:10042282-10042304 AACTTTTTATTTTAGATTCAGGG - Intergenic
1064256727 10:13748675-13748697 CATTTCTGATTTGGGATTTTGGG - Intronic
1064801124 10:19073427-19073449 CACTTTGGATTTCAGATTTTTGG - Intronic
1065291446 10:24234199-24234221 CATTTCAGATTTTGGATTTTTGG + Intronic
1065367449 10:24950443-24950465 CATTTCGGATTTTGGATTTTTGG + Intronic
1066409068 10:35148268-35148290 CATTTCAGATTTTGGATTTTTGG + Intronic
1066472100 10:35709059-35709081 CAATTTTGATGTTGGATTTATGG - Intergenic
1066692227 10:38041676-38041698 CATTTCAGATTTTAGATTTCTGG + Intronic
1067000490 10:42606953-42606975 CATTTCAGATTTTAGATTTCTGG - Intronic
1068203226 10:53812175-53812197 TACTGCTGATTCTAAATTTAAGG + Intronic
1068407990 10:56617599-56617621 CATTTCCTATTTTTGATTTATGG + Intergenic
1069531159 10:69220560-69220582 CCCTTCTGATTTTTTTTTTAAGG - Intronic
1070894220 10:79968196-79968218 CAACTTTTATTTTAGATTTAGGG + Intronic
1071146940 10:82586210-82586232 CAACTTTTATTTTAGATTTAGGG - Intronic
1071148277 10:82600793-82600815 TAATTTTTATTTTAGATTTATGG + Intronic
1071182578 10:83004174-83004196 CAGTGCTGCTTTTACATTTAAGG - Intergenic
1071336498 10:84604713-84604735 CACTTCTGCTCTGAGCTTTAAGG + Intergenic
1071590398 10:86867167-86867189 CATTTCAGATTTCAGATTTTTGG - Intronic
1071755290 10:88531162-88531184 AACATCTGATTTTAGTTTTCAGG + Intronic
1071893073 10:90033458-90033480 CAACTTTTATTTTAGATTTAAGG - Intergenic
1071910417 10:90225828-90225850 CACTTCTGTTTTAAATTTTAAGG - Intergenic
1072489616 10:95891422-95891444 CATTTCAGATTTCAGATTTTGGG - Intronic
1072893185 10:99343499-99343521 CACTTCTGTCTTTAGATCTCTGG - Intronic
1073369774 10:102977309-102977331 CATTTCAGATTTTGGATTTTTGG - Intronic
1073408131 10:103316477-103316499 CAATTCTGATTTTACAGATAGGG + Intronic
1074292897 10:112154136-112154158 TACTTCAGATTTTTGATTTTGGG - Intronic
1074319229 10:112385819-112385841 CATTTCTGTTTATAGATTTTAGG + Intronic
1074444260 10:113505641-113505663 CACTTTAGATTTTAGGATTAGGG - Intergenic
1074633967 10:115292211-115292233 CACTTCTGATTTTATTTATCTGG + Intronic
1076699423 10:132263570-132263592 CAATTTTTATTTTAGATTTGAGG - Intronic
1076986352 11:238771-238793 GATTTCAGATTTTTGATTTATGG - Intronic
1078363455 11:10688024-10688046 CATTTCAGATTTTGGATTTTTGG + Intronic
1078765400 11:14292119-14292141 CATTTCAGATTTCAGATTTTTGG + Intronic
1078861744 11:15254392-15254414 TACCTCTGATTTTAGATTAGAGG + Intergenic
1079106915 11:17577682-17577704 CACTTCTGGCTTTGGATTTCTGG + Intronic
1079289105 11:19170630-19170652 ATCTTCTGATTTTAAATTCAAGG - Intronic
1080177911 11:29389440-29389462 CAAATTTTATTTTAGATTTAGGG + Intergenic
1080275529 11:30499372-30499394 CATTTCAGATTTTGGATTTTGGG - Intronic
1081381026 11:42415604-42415626 CACTTCTGCTTCAAGTTTTAAGG + Intergenic
1081748575 11:45490233-45490255 CATTTCCGATTTCAGATTTTTGG - Intergenic
1081936947 11:46911393-46911415 ACCTTCTGATTTGAGATGTAGGG - Intronic
1084737440 11:71114691-71114713 CACTTCTGATTCTAGATTTCAGG + Intronic
1084850994 11:71940300-71940322 TACTTCTTATTTTAGAATTATGG - Intronic
1084989989 11:72913678-72913700 CACTTCTGATTTTATTTATTTGG + Intronic
1085370544 11:75999826-75999848 CATTTCAGATTTCAGATTTTAGG + Intronic
1085433574 11:76479187-76479209 CATTTCAGATTTCAGATTTTCGG - Intronic
1086290566 11:85304513-85304535 CATTTCAGATTTCAGATTTTGGG - Intronic
1087514738 11:99143650-99143672 CACTACTGATTTTACCTTTTTGG + Intronic
1087928049 11:103943179-103943201 CATTTCAGAGTTTAGATTTTTGG - Intronic
1088018172 11:105085388-105085410 TATTTCTGATTTTAGGTTTTGGG - Intronic
1088344016 11:108802243-108802265 CATTTCAGATTTCAGATTTTTGG - Intronic
1088358119 11:108964243-108964265 CAACTCTTATTTTAGATTCAGGG - Intergenic
1088405589 11:109473579-109473601 CATTTCTGATTTTAGTTATTTGG - Intergenic
1088636112 11:111822050-111822072 CACTTCTAATGTTTGTTTTATGG - Intronic
1088751408 11:112845031-112845053 CACTTTGGATTTTAGATTTTTGG - Intergenic
1088927517 11:114317266-114317288 CAATTTTAATTTTAGATTCAGGG - Intergenic
1089714769 11:120348408-120348430 CATTTCTGATTTTGGATTTTTGG - Intronic
1089763662 11:120747502-120747524 CACTCCTGACTTTACATCTAGGG - Intronic
1091112232 11:132980441-132980463 CACTTCCTATTTTAGTTCTAGGG - Intronic
1091867130 12:3850323-3850345 GAATTCTGATTTCAGATTTTTGG - Intronic
1091896852 12:4111946-4111968 CATTTCAGATTTTGGATTTTTGG - Intergenic
1093106926 12:15098092-15098114 AACTTTTATTTTTAGATTTAGGG + Intergenic
1093959942 12:25261385-25261407 CATTTCTTATTTTATCTTTATGG + Intergenic
1094138963 12:27160793-27160815 CAACTTTGATTTTAGATTCATGG - Intergenic
1094262508 12:28517310-28517332 CACTTCTGAATTCAGATCTCAGG - Intronic
1095234019 12:39775976-39775998 CATTTTGGATTTTAGATTTTTGG + Intronic
1095235928 12:39795758-39795780 GACTTCTGATTTTAAATTATTGG + Intronic
1095513619 12:42980973-42980995 CTTTTCTGATTTTCTATTTAAGG + Intergenic
1096010383 12:48208840-48208862 CAACTTTTATTTTAGATTTATGG - Intergenic
1096337235 12:50765462-50765484 CCCTTCTGACTTTAAATATAGGG + Intronic
1096989062 12:55783753-55783775 CTCTTCATATTTTAGATTTATGG - Intronic
1097418491 12:59344496-59344518 CACTGCTGATTTTACTTTTAGGG + Intergenic
1097587473 12:61531671-61531693 CAACTCTTATTTTAGATTGAGGG - Intergenic
1097782494 12:63724102-63724124 CATTTCAGATTTTAGATTTGTGG - Intergenic
1097916607 12:65027079-65027101 CAACTTTTATTTTAGATTTAGGG + Intergenic
1098383030 12:69889497-69889519 CATTTCAGATTTCAGATTTTTGG - Intronic
1098460552 12:70728668-70728690 CACTTTGGATTTTGGATTTTTGG + Intronic
1098560658 12:71867848-71867870 CATTTCAGATTTAAGATTTTTGG + Intronic
1098643413 12:72866976-72866998 CATTTCAGATTTCAGATTTTGGG + Intergenic
1098645497 12:72895499-72895521 CAGTACTGTTTTTAGATATAAGG + Intergenic
1099073369 12:78074789-78074811 TAATTCTGATTTGAGATGTAGGG + Intronic
1099114285 12:78604750-78604772 CAATTTTTATTTTAGATTCAGGG - Intergenic
1099126990 12:78773600-78773622 CACTTTTAAGTTTAGAATTAAGG - Intergenic
1100071709 12:90728665-90728687 CACTCCAGATTTTAGATTTTTGG - Intergenic
1100161213 12:91863259-91863281 CACTTCTGATTCTAGAAATAGGG + Intergenic
1101179562 12:102199679-102199701 CATTTCAGATTTCAGATTTTGGG - Intergenic
1101232831 12:102758629-102758651 CATTTCAGATTTTGGATTTTGGG - Intergenic
1101260453 12:103024444-103024466 CATTTTGGATTTTAGATTTTTGG + Intergenic
1101621137 12:106389665-106389687 CATTTCAGATTTTGGATTTCTGG - Intronic
1101669165 12:106850890-106850912 CATTTCTGATTTCAGATTCTAGG + Intronic
1102032209 12:109747061-109747083 TACTTTGGATTTTAGATTTGGGG + Intronic
1102834068 12:116037204-116037226 CATTTCTGATTTTTGGATTAGGG - Intronic
1103266269 12:119633208-119633230 CAATTCTCATTTTATAGTTAGGG - Intronic
1103643912 12:122375716-122375738 CCCTTCTGATTTTTAATTTTTGG - Intronic
1104795973 12:131518030-131518052 CAACTTTTATTTTAGATTTAGGG - Intergenic
1105991162 13:25622561-25622583 CATTTCGGATTTTGGATTTTTGG - Intronic
1106418058 13:29562377-29562399 CATTTCAGATTTTGGATTTTTGG - Intronic
1106984375 13:35327757-35327779 CAATTTTTATTTTAGATTCAGGG - Intronic
1108085062 13:46779393-46779415 CATTTCTGATTTTGGATTTTTGG - Intronic
1108160907 13:47638107-47638129 CATTTCTGATTTTATTTTTGGGG - Intergenic
1108398774 13:50017533-50017555 AGCTTCTGATTTTGGAATTATGG - Intronic
1109094895 13:58101561-58101583 CAACTTTTATTTTAGATTTAAGG + Intergenic
1109210121 13:59525513-59525535 GATTTCAGATTTTAGATTTTTGG + Intergenic
1109357021 13:61244561-61244583 CAATTTTTATTTTAGATATAGGG + Intergenic
1109386936 13:61642556-61642578 TATTTCAGATTTTAGATTTTGGG + Intergenic
1109580034 13:64318512-64318534 CAATTTTTATTTTAGATTCAGGG + Intergenic
1109889950 13:68598170-68598192 CATTTCAGATTTCAGATTTTGGG + Intergenic
1110013214 13:70365341-70365363 CAACTTTTATTTTAGATTTAGGG - Intergenic
1110081120 13:71314086-71314108 CATTTCTAATTATAGTTTTAAGG + Intergenic
1110394449 13:75013080-75013102 CACTTCTCATTTTAAATATTAGG - Intergenic
1110811148 13:79811737-79811759 CACTTGTTATTTTAGTTTTGCGG - Intergenic
1110971296 13:81765315-81765337 CAACTTTGATTTTAGATTCAGGG + Intergenic
1111443400 13:88311231-88311253 AACTTCTGTTTTTAGGTTTGGGG - Intergenic
1111983255 13:95039225-95039247 CATTTCAGATTTTGGATTTTCGG - Intronic
1112254349 13:97815786-97815808 CAATTTTTATTTTAGATTCAGGG - Intergenic
1112271244 13:97972357-97972379 CACTACTGCTCTTAGTTTTATGG - Intronic
1113446179 13:110369281-110369303 CCCTTCAGATTTTGGATTTTTGG - Intronic
1114751867 14:25213404-25213426 CACCTTTTATTTTAGATATAAGG + Intergenic
1114864472 14:26571859-26571881 CAATTCTGATTCTAGGTTTAGGG - Intronic
1115178268 14:30591042-30591064 CATTTTGGATTTTAGATTTTTGG + Intronic
1115288848 14:31747669-31747691 CACTTCTGATTTTATTTATCTGG + Intronic
1116085019 14:40224554-40224576 CAAATTTGATTTTAGATTCAGGG - Intergenic
1116245199 14:42402259-42402281 CATTTCTGATTTCTGATTTCTGG - Intergenic
1116304572 14:43234189-43234211 CAATTTTTATTTTAGATTTAGGG + Intergenic
1116410908 14:44622348-44622370 CATTTCAGATTTCAGATTTTTGG - Intergenic
1116414306 14:44662103-44662125 CACCTCTGTTTTGAGATTTGAGG + Intergenic
1116451679 14:45073868-45073890 CAATTCTAATTTTACATATAGGG - Exonic
1116674908 14:47893565-47893587 CAATTTTTATTTTAGATTCAGGG - Intergenic
1116967876 14:51032941-51032963 CACTTCAGATTTCAGATTTTTGG + Intronic
1117154194 14:52921774-52921796 CATTTCAGATTTCAGATTTTTGG + Intronic
1117283875 14:54267173-54267195 CACTTTTCATTTTATAATTAAGG - Intergenic
1117786556 14:59291901-59291923 CACTTCCCATTTAAGATCTAGGG + Intronic
1117895356 14:60479526-60479548 CAATTTTTATTTTAGATTCAGGG - Intronic
1118624055 14:67640895-67640917 CATTTCCGATTTTGGATTTCTGG - Intronic
1119627070 14:76187141-76187163 CACATGTGATTTTACCTTTAAGG - Intronic
1120307033 14:82784067-82784089 CAATACTTATTTTAGATTCAGGG + Intergenic
1120409698 14:84137542-84137564 CACTTCTAATTTTACACATATGG + Intergenic
1121958992 14:98240982-98241004 CATTTCAGATTTTGGATTTTGGG - Intergenic
1122620058 14:103051197-103051219 CACTTCTGATTTTAGATTTAAGG + Intronic
1123460771 15:20468369-20468391 CATTTCAGATTTTGGATTTTGGG + Intergenic
1123657290 15:22532047-22532069 CATTTCAGATTTTGGATTTTGGG - Intergenic
1124087434 15:26564142-26564164 CATTTCAGATTTTGGATTTTTGG + Intronic
1124209099 15:27747468-27747490 CACTGCTGGTTTTAGATGTTGGG + Intergenic
1124271410 15:28284161-28284183 CATTTCAGATTTTGGATTTTGGG + Intronic
1124311202 15:28627256-28627278 CATTTCAGATTTTGGATTTTGGG - Intergenic
1124452615 15:29810048-29810070 CATTTCAGATTTCAGATTTTTGG - Intronic
1125030664 15:35072785-35072807 CAACTTTTATTTTAGATTTAAGG + Intergenic
1125046821 15:35251209-35251231 CAATTTTTATTTTAGATTCAGGG + Intronic
1125077243 15:35633658-35633680 CCCCTCTGATGTTAGATTAATGG - Intergenic
1125223743 15:37370470-37370492 CAATTTTTATTTTAGATTCAGGG + Intergenic
1125302536 15:38271761-38271783 CCATTCTTATTTTAGATTTGGGG + Intronic
1126269354 15:46795708-46795730 CATTTCTGATTTTATATATTTGG - Intergenic
1126443575 15:48717991-48718013 CTCTTCTGAATTAAGGTTTAGGG - Intronic
1126455289 15:48854952-48854974 CAATTTTTATTTTAGATTGAGGG - Intronic
1127239849 15:57101149-57101171 TATTTGTGATTTTAGATTTTAGG + Intronic
1127431891 15:58918819-58918841 AACTTCTAATTTTAGATTTTAGG - Intronic
1127706273 15:61550143-61550165 AATTTCTGACTTTAGATATATGG - Intergenic
1127744815 15:61956464-61956486 CAATTTTTATTTTAGATTCAGGG - Intronic
1127939259 15:63677171-63677193 CACTTTGGATTTTGGATTTTTGG + Intronic
1128498902 15:68213725-68213747 CATTTCAGATTTCAGATTTTTGG + Intronic
1128567770 15:68712473-68712495 CATTTCAGATTTTGGATTTGGGG + Intronic
1128619869 15:69139633-69139655 CCTTTCAGATTTTAGAATTATGG + Intergenic
1129134676 15:73536879-73536901 CAATTTTCATTTTAGATTCAGGG + Intronic
1129855784 15:78824026-78824048 CATTTCAGATTTTGGATTTTTGG - Intronic
1130280533 15:82516806-82516828 CATTTCAGATTTTGGATTTTCGG - Intergenic
1130471904 15:84232989-84233011 CATTTCAGATTTTGGATTTTCGG - Intergenic
1130479398 15:84347560-84347582 CATTTCAGATTTTGGATTTTCGG - Intergenic
1130492372 15:84440569-84440591 CATTTCAGATTTTGGATTTTCGG + Intergenic
1130594201 15:85237626-85237648 CATTTCAGATTTTGGATTTTCGG - Intergenic
1130675023 15:85944290-85944312 CAATTTTTATTTTAGATTCAGGG + Intergenic
1130701144 15:86183536-86183558 CATTTCTGTTTTTAAATTTGAGG - Intronic
1130820580 15:87491058-87491080 TACTTTTTATTTTAGGTTTAGGG + Intergenic
1131219294 15:90568128-90568150 CACTTCTAATTCTAGATCTCTGG - Intronic
1131380619 15:91960836-91960858 CATTTCAGATTTTGGATTTTTGG - Intronic
1131381994 15:91972038-91972060 CATTTCAGATTTTGGATTTTTGG + Intronic
1131585447 15:93688190-93688212 CAACTTTTATTTTAGATTTAAGG - Intergenic
1131933948 15:97480285-97480307 CAATTCTTATTTTAGGTTTAGGG - Intergenic
1132613850 16:830806-830828 GTCTTCTGACTTTGGATTTAGGG + Intergenic
1133251157 16:4482397-4482419 CACTTCTGATACCAGATATATGG + Intronic
1133527658 16:6621521-6621543 CTCTTGAGATTTTTGATTTAGGG - Intronic
1133935072 16:10262533-10262555 CATTTTTTATTTTTGATTTAGGG - Intergenic
1134357375 16:13495634-13495656 CATTTCTGATTTTAAATATTTGG + Intergenic
1135307016 16:21376081-21376103 CAATTTTTATTTTAGATTCAGGG + Intergenic
1135344401 16:21676247-21676269 CACTTCGGATTTTACATTGCTGG + Intergenic
1135467483 16:22699708-22699730 CATTTCTAATTTCAGATTTTTGG - Intergenic
1136303760 16:29355221-29355243 CAATTTTTATTTTAGATTCAGGG + Intergenic
1136633589 16:31504593-31504615 CATTTCAGATTTTAGGTTTTTGG - Intronic
1137836891 16:51600850-51600872 CACTTCTGATTTCAGATTTTTGG - Intergenic
1137860356 16:51840664-51840686 CATTTCTGATTTTGGACTTTTGG - Intergenic
1137864240 16:51876784-51876806 GACTTCTGTTTTTATATTGATGG - Intergenic
1137919932 16:52476979-52477001 CACCTTTTATTTTAGATTCAGGG + Intronic
1137926051 16:52543312-52543334 CATTTCGGATTTCAGATTTTTGG - Intronic
1138241733 16:55432969-55432991 AACTTCTGATTTTGGATGTTCGG - Intronic
1138772154 16:59678609-59678631 TACTTCTGAGATTAGATTTGAGG - Intergenic
1138920313 16:61520169-61520191 CATTTCAGATTTTGGATTTTGGG - Intergenic
1139162097 16:64522543-64522565 CATTTCTGTTTTTAGATCTTTGG - Intergenic
1139343096 16:66283812-66283834 CAATTTTTATTTTAGATTCAGGG - Intergenic
1139416883 16:66819727-66819749 CATTTCTGATTTTGGATTTTTGG + Intronic
1139815712 16:69669252-69669274 CATTTAAGATTTTAGATTTTTGG + Intronic
1140927138 16:79594241-79594263 CACTCCTGCTTTTCGATTTATGG - Exonic
1143296519 17:5875531-5875553 CATTTCAGATTTTGGATTTTTGG - Intronic
1143440884 17:6972741-6972763 CAATTTTTATTTTAGATTTGGGG + Intronic
1143453115 17:7048491-7048513 CTCTTTTGTTTTTAGAGTTAAGG - Intergenic
1143928829 17:10399131-10399153 CATTTCAGATTTTAGATTTTCGG - Intronic
1144129922 17:12236654-12236676 CATTTCTGAGTTTTGTTTTACGG - Intergenic
1144676107 17:17162788-17162810 CATTTCAGATTTTGGATTTTTGG + Intronic
1146075785 17:29727463-29727485 AACTACTGATTTTAGAACTAGGG - Intronic
1146249911 17:31330614-31330636 CTCTTCTGATTTTATATCTGTGG + Intronic
1146566823 17:33920695-33920717 CAACTTTGATTTTAGATTCAGGG - Intronic
1146829512 17:36056228-36056250 CACTGCTAATTATAGAGTTATGG + Intergenic
1148916200 17:50981096-50981118 CATTTCAGATTTCAGATTTTTGG - Intronic
1150090375 17:62319058-62319080 CTCTTCTCTTTTGAGATTTATGG - Intergenic
1150306460 17:64089378-64089400 CATTTCAGATTTTGGATTTTCGG - Intronic
1150437512 17:65165408-65165430 TGCCTCTGATTTCAGATTTAGGG + Intronic
1150948409 17:69773909-69773931 CAACTTTTATTTTAGATTTAAGG - Intergenic
1151030292 17:70730078-70730100 CAACTTTTATTTTAGATTTAGGG - Intergenic
1153009734 18:527546-527568 CACTGCTGAATATAGATTTGGGG + Intergenic
1153118797 18:1694581-1694603 CATTTCTGAATTTGCATTTATGG + Intergenic
1153141243 18:1974806-1974828 CACTTCTGCTTTAAGCTGTAGGG + Intergenic
1154275869 18:12959583-12959605 CATTTCAGATTTCAGATTTTTGG + Intronic
1154308683 18:13250516-13250538 CACTTCTGATTTTATTTATTTGG - Intronic
1155022183 18:21906607-21906629 CATTTGTGATTTGACATTTACGG + Intergenic
1155230476 18:23769127-23769149 CAACTCTAATTTTAGATTCAGGG - Intronic
1155465107 18:26125801-26125823 CACTTCAGATTTTGTATTTTTGG - Intergenic
1155534191 18:26799175-26799197 CACCTCTGATTTTATTTATATGG - Intergenic
1155995817 18:32330491-32330513 CAATTTTTATTTTAGATTCAGGG - Intronic
1156346471 18:36261212-36261234 CATTTCAGATTTCAGATTTTTGG - Intronic
1157644131 18:49249775-49249797 CACTTCAGATTTTAAGTGTATGG - Intronic
1157667286 18:49498573-49498595 CATTTCGGATTTCAGATTTTCGG + Intergenic
1157679419 18:49592592-49592614 CATTTCGGATTTTGGATTTTTGG + Exonic
1158671921 18:59483411-59483433 CATTTCAGATTTCAGATTTTTGG - Intronic
1158951965 18:62503407-62503429 CATTTCAGATTTTAGATTTTCGG - Intergenic
1158960265 18:62582351-62582373 CAATTCTCATTTTACATCTAGGG - Intronic
1159378279 18:67622591-67622613 CATTTCTGATTTCAGATTCTGGG - Intergenic
1159570696 18:70109228-70109250 CATTTCAGATTTTGGATTTTTGG - Intronic
1159802134 18:72914213-72914235 TAGTTCTGATTTTAGTTTTGAGG + Intergenic
1160334235 18:78023306-78023328 CACTTGTGAATTTCCATTTAGGG + Intergenic
1160487210 18:79304517-79304539 CATTTCCAATTTTAGATTTTTGG + Intronic
1161802172 19:6422367-6422389 CACTCCTGATTTTGGTTTTGGGG - Exonic
1162285245 19:9733906-9733928 TATTTCTGATTGTAGACTTATGG - Intergenic
1163818147 19:19480407-19480429 AAATTCTGATTTTTGATTAATGG + Intronic
1164447195 19:28328037-28328059 CAATTTTCATTTTAGATTCAGGG + Intergenic
1164497109 19:28776484-28776506 CATTTCTGATTGTAGGTTTTTGG - Intergenic
1164771073 19:30809440-30809462 CAACTCTTATTTTAGATTCAGGG + Intergenic
1166270869 19:41712943-41712965 CATTTCAGATTTTGGATTTTAGG - Intronic
1166335830 19:42106607-42106629 CAGTTTTTATTTTAGATTCAGGG - Intronic
1167732168 19:51266245-51266267 CATTTCGGATTTTGGATTTTTGG - Intronic
1168596344 19:57681130-57681152 CATTTTGGATTTTAGATTTTTGG - Intergenic
925073453 2:989801-989823 CAATTCTTTTGTTAGATTTAGGG + Intronic
925581935 2:5419780-5419802 CACTTTTGATTATGGATTTGTGG - Intergenic
925813857 2:7727987-7728009 CACTTCAGATTTTGGATTTTGGG - Intergenic
926522827 2:13938067-13938089 CAATTCTGATTTCAGATTTCTGG - Intergenic
927449602 2:23196323-23196345 CATTTCAGATTTCAGATTTTTGG + Intergenic
927466402 2:23339964-23339986 CATTTCAGATTTTGGATTTTTGG + Intergenic
927486287 2:23490672-23490694 GATTTCTGACTTTGGATTTATGG + Intronic
927535697 2:23856375-23856397 CATTTCAGATTTCAGATTTTTGG + Intronic
927695550 2:25237225-25237247 CACTTTTGAATTTACCTTTAAGG - Intronic
927745206 2:25613249-25613271 CAATTTTTATTTTAGATTGAGGG + Intronic
928120962 2:28583151-28583173 CATTTCAGATTTCAGATTTTCGG - Intronic
928177624 2:29045747-29045769 CATTTCCGATTTCAGATTTTTGG + Intronic
928393949 2:30930030-30930052 CATTTTGGATTTTAGATTTTTGG + Intronic
928478639 2:31657302-31657324 AACTTTTAATTTTAGATGTATGG - Intergenic
928642759 2:33318064-33318086 CATTGCAGATTTTAGATTTTTGG + Intronic
928992324 2:37246891-37246913 CAACTTTTATTTTAGATTTAGGG + Intronic
930312433 2:49758016-49758038 CAATTTTTATTTTAGATTGAGGG - Intergenic
930683166 2:54279465-54279487 AACTTTTCATTTTAGAATTATGG + Intronic
931167653 2:59765481-59765503 CAATTCTACTTTTAAATTTAAGG - Intergenic
931496182 2:62809511-62809533 CAATTTTTATTTTAGATTCAAGG + Intronic
931533487 2:63244958-63244980 CACTTCAGATTTTGGATTTTTGG - Intronic
931814562 2:65888059-65888081 TACCTCTGATTATATATTTAAGG - Intergenic
931983589 2:67720536-67720558 CATTTCAGATTTCAGATTTTTGG + Intergenic
932072263 2:68633187-68633209 CAATTTTTATTTTAGATTCAGGG + Intergenic
932596715 2:73098229-73098251 CATTTCAGATTTCAGATTTTTGG - Intronic
932856161 2:75235943-75235965 CACTTTTTCTTTTAGATTCAGGG + Intergenic
933056384 2:77672950-77672972 GACTTTTGCTTTTAGATTTCAGG - Intergenic
933230829 2:79805498-79805520 CATTTCAGATTTCAGATTTATGG + Intronic
933460039 2:82570878-82570900 CACTTCTTGTTTTAGATCTTGGG - Intergenic
933834029 2:86231591-86231613 CATCTCTGTTTATAGATTTAAGG + Intronic
933927940 2:87117265-87117287 GACTTTTGCTTTTAGATTTCAGG - Intergenic
934938017 2:98479217-98479239 CACTTCTAATTTTAGAAGTGTGG + Intronic
936120493 2:109738667-109738689 CACTTCTGATTTTATTTATTTGG + Intergenic
936224202 2:110632779-110632801 CACTTCTGATTTTATTTATTTGG - Intergenic
936381517 2:111990790-111990812 CATTTCAGATTTCAGATTTTGGG + Intronic
936728214 2:115348503-115348525 AACTTTTTATTTTAGATTTAGGG + Intronic
936801793 2:116278438-116278460 CACTTCTGATTTTAACTATCTGG + Intergenic
936805114 2:116322227-116322249 CAATTCAGATTTTAAACTTAAGG + Intergenic
936826674 2:116589825-116589847 CAATTTTTATTTTAGATTCAGGG - Intergenic
937022132 2:118667245-118667267 CTCTTATGATTTCAGGTTTATGG - Intergenic
937330985 2:121029664-121029686 CACTTCAGATTTTGGATTTTCGG + Intergenic
937709776 2:124966590-124966612 CACTTCTCATTTGTGATCTAAGG - Intergenic
938597143 2:132799384-132799406 CACCTTTTATTTTAGATTCAGGG - Intronic
938879930 2:135575128-135575150 CACTTCAGATTTTGGATTAAGGG + Intronic
939645742 2:144696749-144696771 CAACTTTTATTTTAGATTTAGGG + Intergenic
939648270 2:144729274-144729296 CACCTTTTATTTTAGATTCAGGG + Intergenic
939927077 2:148188121-148188143 CATTTCAGATTTTGGATTTTTGG + Intronic
940681759 2:156794647-156794669 CAAGTTTGATTTTAGATTTTAGG - Intergenic
940824244 2:158392491-158392513 TATTTCAGATTTTAGATTTTTGG + Intronic
940931276 2:159435064-159435086 CACTACTGATTTTAATTTCAAGG - Intronic
941783393 2:169473611-169473633 CATCTCTTATTTTAGATTTGGGG - Intergenic
941929436 2:170925436-170925458 CACTTTGGATTTTGGATTTTTGG + Intergenic
942266032 2:174226232-174226254 CAATTCTGATTTGTGATTTATGG + Intronic
942719558 2:178935666-178935688 TAGTTCTGCTTTTAGCTTTAAGG + Intronic
942768371 2:179484815-179484837 AACTTTTGATTTGAGATTTGAGG + Intronic
943036736 2:182756097-182756119 CATTTCAGATTTAAGATTTTTGG - Intronic
943121019 2:183735829-183735851 CAACTTTTATTTTAGATTTACGG + Intergenic
943204106 2:184869065-184869087 CATTTCGGATTTTGGATTTTCGG + Intronic
943304051 2:186237381-186237403 CCATTCTGATTTGATATTTATGG - Intergenic
943428577 2:187768978-187769000 CAATTTTTATTTTAGATTCATGG + Intergenic
943432336 2:187819523-187819545 GACTTCTGCTTTTAGATAGATGG + Intergenic
944852341 2:203732809-203732831 CACTGCTGTGTTTAGAGTTAGGG + Intronic
944982817 2:205141532-205141554 CACTTCTGAGTTTTGATATGGGG - Intronic
945131167 2:206574214-206574236 CATTTCTGATCTTAGATTTTTGG + Intronic
945312257 2:208327805-208327827 CACTTTAGAATTTAGATTTCTGG + Intronic
945590341 2:211721250-211721272 CATTTCAGATTTTGGATTTTTGG + Intronic
945640259 2:212417391-212417413 CATTTCAGATTTTAGATTTTTGG - Intronic
945712044 2:213309140-213309162 CATTTCAGATTTTGGATTTTCGG + Intronic
945722670 2:213438002-213438024 CAGTGCTGGTTTTGGATTTAGGG + Intronic
945893935 2:215461205-215461227 CATTTCTGATTATAAATTGATGG - Intergenic
945931407 2:215858911-215858933 CACAGCTGATTATAGATCTAGGG + Intergenic
946059414 2:216928873-216928895 CACTTTGGATTTCAGATTTTTGG - Intergenic
946129675 2:217596575-217596597 CATTTCAGATTTTGGATTTTTGG + Intronic
946264114 2:218523426-218523448 CATTTCAGATTTCAGATTTTTGG + Intronic
946503865 2:220278422-220278444 CATTTAGGATTTTAGATTTTTGG + Intergenic
946777090 2:223154540-223154562 CAATTTTAATTTTAGATTGAAGG - Intronic
947685942 2:232084393-232084415 CATTTCAGATTTCAGATTTTAGG - Intronic
948176701 2:235949204-235949226 CCCTTCGGATTTTGGATTTTGGG - Intronic
1169339295 20:4784040-4784062 GACTTTTGATTTTAGTTATAAGG - Exonic
1169613531 20:7411700-7411722 TACCTTTTATTTTAGATTTAGGG + Intergenic
1169996494 20:11563337-11563359 CAACTTTTATTTTAGATTTAGGG - Intergenic
1170179042 20:13508367-13508389 CATTTCAGCTTTTAGATTTTTGG - Intronic
1170238836 20:14139774-14139796 CATTTCAGATTTTGGATTTTTGG - Intronic
1170347999 20:15408138-15408160 AACTTCTGGTTTTAAATTCATGG - Intronic
1170625509 20:18027087-18027109 CAACTTTGATTTTAGATTCAGGG - Intronic
1170788022 20:19484436-19484458 CATTTCAGATTTCAGATTTTTGG + Intronic
1170859211 20:20087142-20087164 CAATTTTTATTTTAGATTTAGGG + Intronic
1171169767 20:23005519-23005541 CATTTCAGATTTTAAATTTTTGG - Intergenic
1172497469 20:35398541-35398563 CACTTTTCATTTGAAATTTAAGG - Intronic
1173090255 20:39964057-39964079 CACTTCTGATATTAGATGTGTGG + Intergenic
1173105122 20:40126470-40126492 CAACTTTTATTTTAGATTTAGGG + Intergenic
1173572197 20:44084697-44084719 GACATCTGATGTTGGATTTAGGG - Intergenic
1173719831 20:45246598-45246620 CATTTCAGATTTCAGATTTCTGG - Intergenic
1176889221 21:14294078-14294100 CCATTCTGTTTTTACATTTAAGG - Intergenic
1177131377 21:17260312-17260334 CAAATCAGAGTTTAGATTTAAGG - Intergenic
1177315238 21:19451841-19451863 CATTTCAGATTTTGGATTTTTGG - Intergenic
1177323061 21:19546720-19546742 CACTCCTAATGTTAGATGTATGG - Intergenic
1177587192 21:23112377-23112399 CAGTTCTGATATCAGAATTATGG + Intergenic
1178129786 21:29559229-29559251 CACTGCTGATTTTAGTTAAACGG - Intronic
1179203310 21:39247392-39247414 CATTTCAGATTTTGGATTTTTGG - Intronic
1179617551 21:42591895-42591917 TACTTCTGATTTTAAAGATAAGG - Intergenic
1180839264 22:18951271-18951293 CACTTCTGATTATAAAACTAAGG + Intergenic
1181794566 22:25296143-25296165 CAGCTTTAATTTTAGATTTAAGG + Intergenic
1181834547 22:25592657-25592679 CAGCTTTAATTTTAGATTTAAGG + Intronic
1182767659 22:32770169-32770191 CAATTCTGATTTTATTTTGAAGG - Intronic
1182790537 22:32949055-32949077 CATTTCAGATTTTGGATTTTGGG - Intronic
1184815452 22:46865447-46865469 CATTTCAGATTTTAGATTTTTGG - Intronic
1185084348 22:48730919-48730941 CACTTCTAGCTTTTGATTTAAGG - Intronic
949197382 3:1328668-1328690 TACTTCTGATCTTAGATTAAAGG - Intronic
949267648 3:2177704-2177726 AACTTCAGTTTTTACATTTAAGG + Intronic
949313898 3:2730368-2730390 CATTTCAGATTTTGGATTTTTGG + Intronic
950562575 3:13743245-13743267 TAATTTTAATTTTAGATTTAGGG + Intergenic
950945405 3:16940619-16940641 CAACTCTTATTTTAGGTTTAGGG - Intronic
950977910 3:17269494-17269516 CAATTTTTATTTTAGATTCATGG + Intronic
951479305 3:23142372-23142394 CAATTTTTATTTTAGATTCAGGG - Intergenic
951792272 3:26499295-26499317 GACTTCTGGCTTTTGATTTAGGG - Intergenic
951831911 3:26939676-26939698 CACTTCCAATTTTAAATTAATGG - Intergenic
952293904 3:32044082-32044104 CAACTTTTATTTTAGATTTAAGG - Intronic
952619831 3:35324354-35324376 AAATTCTTATTTTAGATTTAAGG - Intergenic
953258069 3:41308759-41308781 CATTTCAGATTTCAGATTTTTGG + Intronic
953294342 3:41698253-41698275 CATTTCAGATTTTAGATTTTTGG - Intronic
953304744 3:41817753-41817775 CAACTTTTATTTTAGATTTAGGG - Intronic
953334763 3:42085089-42085111 CATTTCAGATTTCAGATTTTTGG + Intronic
953777392 3:45832433-45832455 CATTTCAGATTTCAGATTTTTGG + Intronic
953915685 3:46919535-46919557 CACTTCTGTTTCTAGTTTCATGG - Intergenic
955021577 3:55126760-55126782 CAATTTTTATTTTAGATTCAGGG - Intergenic
955130325 3:56159514-56159536 CAACTTTTATTTTAGATTTAGGG + Intronic
955818164 3:62869094-62869116 CACTTTGGATTTCAGATTTTTGG - Intronic
956151492 3:66247827-66247849 AACTTTTGATTTCAGATTCATGG + Intronic
956330192 3:68098340-68098362 CACTTCTGTCTTTTGATTTGGGG + Intronic
957212143 3:77272965-77272987 CAGTTTTTATTTTAGATTTAGGG + Intronic
957590429 3:82190203-82190225 CACTTCTGATTTTTTGTTTTAGG + Intergenic
958427303 3:93993863-93993885 CACAGCAGATTATAGATTTATGG - Intronic
958507998 3:95006386-95006408 CATTTTGGATTTTAGATTTTGGG - Intergenic
958594702 3:96206637-96206659 CACTTTTAATTTTAGGTTCAGGG - Intergenic
958642354 3:96822075-96822097 CTCTTCTGATGTTAGTTGTATGG + Intronic
958656725 3:97011652-97011674 CAACTTTTATTTTAGATTTAAGG + Intronic
959018504 3:101163012-101163034 CAGTACTGATTTGAGATTCATGG - Intergenic
959089048 3:101882822-101882844 CACTTCTGAATCCAGATTTGAGG - Intergenic
959705764 3:109337381-109337403 CACTCCTGATTTTTCCTTTAAGG - Intronic
959795202 3:110418766-110418788 CAACTCTTATTTTAGATTTGGGG - Intergenic
959845372 3:111026492-111026514 CACTTCAGATTTCGGATTTTTGG + Intergenic
960196163 3:114770948-114770970 CATTTCAGATTTCAGATTTTCGG + Intronic
961185718 3:124913426-124913448 GACTTCTGACTTTAGACATATGG - Intronic
961635890 3:128332423-128332445 CACTTTGGATTTTGGATTTCTGG - Intronic
963505619 3:146181178-146181200 CATTTCTGTTTTTAGAGTTCAGG - Intergenic
963593793 3:147299372-147299394 CAACTTTGATTTTAGATTCAGGG - Intergenic
963957640 3:151272930-151272952 CACTTCGGACTTCAGATTTTGGG - Intronic
963987193 3:151609975-151609997 CAATTTTTATTTTAGATTCAAGG - Intergenic
964022771 3:152034141-152034163 CAACTTTTATTTTAGATTTAGGG - Intergenic
964024827 3:152059759-152059781 CAACTTTTATTTTAGATTTAAGG - Intergenic
964192900 3:154025657-154025679 CATTTCAGATTTTGGATTTTTGG - Intergenic
964227474 3:154423788-154423810 CACTTTTTATTTTATATTTTTGG - Intronic
964258557 3:154807520-154807542 CACTTCTGATTTTATTTATTTGG + Intergenic
964348846 3:155782932-155782954 CAGTTCAGATTTCAGATTTGTGG - Intronic
964516254 3:157511643-157511665 CATTTTGGATTTTAGATTTTTGG + Intronic
964727962 3:159834632-159834654 CATTTCAGATTTTAGATTTTGGG - Intronic
964896841 3:161607875-161607897 AAATTATTATTTTAGATTTATGG - Intergenic
964936909 3:162100748-162100770 CATTTCAGATTTAAGATTTTAGG - Intergenic
965914271 3:173822463-173822485 CATTTCAGATATTAGATTTTTGG - Intronic
965965485 3:174483584-174483606 CTTTTGTGATTTTATATTTAAGG - Intronic
966722840 3:183081513-183081535 CACTTCTCATTTTTGCTTGAAGG - Intronic
967386699 3:188919038-188919060 CATTTCAGATTTTGGATTTTTGG + Intergenic
967809996 3:193750801-193750823 CTCTTGTTATTTTAGCTTTAGGG + Intergenic
970977229 4:22056030-22056052 CACTTCTGATCTTAAATGTATGG + Intergenic
971017147 4:22499990-22500012 CATTTTGGATTTTAGATTTTTGG - Intronic
971023751 4:22567170-22567192 CTCCTATGATTTTAGTTTTATGG - Intergenic
971764028 4:30806078-30806100 CATTTCGGATTTCAGATTTTTGG + Intronic
971798481 4:31258856-31258878 CCTTTCTGACTTTAGATTCAGGG - Intergenic
971865527 4:32165575-32165597 CACTTCTAATTTCATATATAAGG - Intergenic
972009180 4:34153937-34153959 CACTTATGATTTTAAATCAAGGG - Intergenic
972488068 4:39561170-39561192 CATTTCAGATTTTGGATTTTAGG - Intronic
972667192 4:41177874-41177896 CATTTCAGATTTCAGATTTTTGG - Intronic
972715482 4:41641802-41641824 CATTTCAGATTTCAGATTTTTGG + Intronic
972772764 4:42213590-42213612 CACCTTTTATTTTAGATTTTAGG + Intergenic
972949992 4:44308656-44308678 CACATCTTATTTAAGGTTTATGG + Intronic
972964491 4:44492780-44492802 CATTTCAGATTTCAGATTTTTGG - Intergenic
973263828 4:48190816-48190838 AACTTCTGATTTTATATTTAGGG - Intronic
973690646 4:53426515-53426537 CATTTCAGATTTCAGATTTTTGG + Intronic
973905518 4:55526032-55526054 CATTTCAGATTTCAGATTTTCGG + Intronic
974276588 4:59728383-59728405 CGCCTCTGATTTTAAATTTTTGG + Intergenic
974338140 4:60578455-60578477 CACTTCTGATTCTTGCTTCATGG - Intergenic
974655293 4:64811349-64811371 CACTTCAGATTTTGAAATTATGG + Intergenic
975235079 4:71984884-71984906 CATTTCAAATTTTAGATTTTTGG + Intergenic
975834402 4:78406865-78406887 CATTTCAGATTTCAGATTTTTGG - Intronic
976310847 4:83611454-83611476 CACTTCTGATTTTATATATTTGG + Intergenic
976380798 4:84396021-84396043 CATTTCAGATTTCAGATTTTTGG + Intergenic
976418260 4:84804962-84804984 CATTTCAGATTTCAGATTTTTGG - Intronic
976650809 4:87432399-87432421 AATTTCTGATTTTGGATTTTTGG + Intronic
976913325 4:90336924-90336946 CACCTTTGATTTTAGGCTTAGGG - Intronic
977190988 4:94000586-94000608 CAATTTTTATTTTAGATTTCAGG + Intergenic
977506949 4:97914738-97914760 CATTTCAGATTTTGGATTTTTGG - Intronic
977621326 4:99140893-99140915 CACCTTTAATTTTAGATTTAAGG + Intronic
977910359 4:102527474-102527496 CACTTCTGTTTTTATTTTTCTGG - Intronic
978195314 4:105965231-105965253 CACTTCTGATTTCATAATTCTGG - Intronic
978209238 4:106115192-106115214 CATTTCAGATTTTAGATTTTTGG - Intronic
978305660 4:107325369-107325391 CATTTCAGATTTCAGATTTTTGG - Intergenic
978487100 4:109267638-109267660 CTCTTCAGATTTCAGATTTTTGG - Intronic
978674851 4:111300329-111300351 TACTTCTGATTTTAGCTCTTTGG + Intergenic
979216048 4:118164480-118164502 AACTTTTAATTTTAGATTCAGGG - Intronic
979932531 4:126648956-126648978 TATTTCTGATTTCAGATTTTTGG + Intergenic
980045221 4:127980509-127980531 CACTTCTAATTTTGCATTTCAGG - Intronic
980268757 4:130555941-130555963 CATCTCTGATTTTAGTTTTTGGG - Intergenic
980938227 4:139246712-139246734 CAGTTGTAATTTTAGTTTTAAGG - Intergenic
981016930 4:139983657-139983679 CATTTCAGATTTCAGATTTTTGG + Intronic
981253032 4:142626590-142626612 CACTTCTGATTTCAGCCTTGTGG + Intronic
981325667 4:143444617-143444639 CAATTTTTATTTTAGTTTTAGGG + Intronic
981334602 4:143556100-143556122 CATTTCTGATTTTTGGATTAGGG + Exonic
981458443 4:144983421-144983443 CATTTCAGATTTTGGATTTTTGG + Intronic
981793662 4:148569562-148569584 TAATTTTAATTTTAGATTTAAGG - Intergenic
982019379 4:151188488-151188510 CATTTCAGATTTCAGATTTTTGG - Intronic
982755778 4:159217176-159217198 TGATTTTGATTTTAGATTTAGGG + Intronic
983329400 4:166305184-166305206 CTCTCCTGGTTTTAGAATTAGGG - Intergenic
983466812 4:168104012-168104034 CACCTTTAATTTTAGATGTAGGG + Intronic
983563738 4:169127959-169127981 CATTTCGGATTTCAGATTTTTGG - Intronic
983595268 4:169458979-169459001 CATTTCAGATTTTGGATTTACGG + Intronic
983743345 4:171163221-171163243 CAATTCTGCTTTTAGACATATGG - Intergenic
983826915 4:172273971-172273993 CATTTTTGATTTTGGAATTATGG - Intronic
983865823 4:172765263-172765285 TACTTCTCATTTTATATTTTGGG - Intronic
983908824 4:173213927-173213949 CACCTTTGATTTTAGACTGAGGG + Intronic
983934052 4:173486883-173486905 CACTTCTGATTTTCCATTCAGGG + Intergenic
985118159 4:186612511-186612533 CATTTCGGATTTCAGATTTTTGG + Intronic
985185708 4:187313349-187313371 CACTTCTTATTTTGCATTTTTGG + Intergenic
985190950 4:187372209-187372231 CACTTCACATTTCAGATTTTTGG + Intergenic
985562712 5:599202-599224 CAACTTTTATTTTAGATTTAGGG + Intergenic
986176828 5:5359717-5359739 CACATCTGATTTTTGAATCATGG - Intergenic
986819659 5:11451462-11451484 CATTTCAGATTTTGGATTTTTGG - Intronic
986836899 5:11649091-11649113 CACTTCTGTATTTATTTTTATGG + Intronic
987164448 5:15180480-15180502 CATTTCTGATTTTAAACTTATGG - Intergenic
987552012 5:19395422-19395444 CACTTAGGTTTTTAGAATTAGGG + Intergenic
987665222 5:20929047-20929069 CACTTCTGATTTTATTTATTTGG + Intergenic
987745281 5:21963149-21963171 TAATTCTAATTTTAGATTCAGGG + Intronic
987866247 5:23542902-23542924 CACCTTTCATTTTAGATTTAGGG + Intergenic
987982305 5:25101781-25101803 CACTTCTAATTCTAGGTTTTTGG + Intergenic
988068814 5:26260626-26260648 TAATTTTTATTTTAGATTTAGGG + Intergenic
988451718 5:31350633-31350655 CACTTCTGAGAGAAGATTTACGG + Intergenic
988612958 5:32745252-32745274 TACTTCTCACTTTAGATTTCAGG - Intronic
988757467 5:34273136-34273158 CACTTCTGATTTTATTTATTTGG - Intergenic
988848435 5:35154229-35154251 GACTTCTTGTTTTATATTTAAGG + Intronic
989021148 5:37010884-37010906 CATTTCCGATTTTAGATTTTTGG - Intronic
989051665 5:37326514-37326536 CAGTTCTGAGTTTAGAATAAAGG + Intronic
989224232 5:39007073-39007095 CACTTTTAATTTTAGGTATATGG - Intronic
989359902 5:40590002-40590024 CAATTTTTATTTTAGATTCAAGG + Intergenic
989374327 5:40744607-40744629 CAGGCCTGATTTTAGATTTCTGG + Intronic
989453735 5:41617673-41617695 CTTTTTTGCTTTTAGATTTAGGG - Intergenic
989542804 5:42637309-42637331 CAACTCTTATTTTAGATTTAGGG + Intronic
989758197 5:44981824-44981846 CAAATTTCATTTTAGATTTAGGG - Intergenic
990782371 5:59379837-59379859 CAATGTTTATTTTAGATTTAGGG + Intronic
991087827 5:62664504-62664526 CATTTCAGATTTCAGATTTTAGG + Intergenic
991126249 5:63072898-63072920 CACTTCAGATTTCAGATTTTTGG + Intergenic
991521226 5:67499278-67499300 CAATTTTTATTTTAGATTCAGGG + Intergenic
992060515 5:73040363-73040385 CACTTTGGATTTCAGATTTTTGG + Intronic
992817633 5:80461069-80461091 CATTTCAGATTTCAGATTTTTGG - Intronic
993199023 5:84788855-84788877 CAATACTGATTTTGGATTTTTGG - Intergenic
993309903 5:86315795-86315817 CACCTCTGATTTTATATTCAGGG + Intergenic
993310193 5:86320313-86320335 CATTTATGATTTTGGATTTTTGG - Intergenic
993311284 5:86336650-86336672 CACTTTTCCTGTTAGATTTAAGG - Intergenic
993876492 5:93313530-93313552 CATTTTAGATTTTAGATTTTTGG - Intergenic
993924351 5:93847357-93847379 CAGTTCTGATTTTAGAATAAGGG + Intronic
993990864 5:94656832-94656854 CACTTCTGATTTTATTTATTTGG + Intronic
994748468 5:103708586-103708608 CACATGTGATTATACATTTATGG + Intergenic
994828447 5:104746424-104746446 CACTTCCGAATTTAGCTTTGGGG - Intergenic
994871475 5:105355161-105355183 CCCCTCTGATTTTAAATTTCAGG + Intergenic
994934234 5:106233057-106233079 CATTTCAGATTTTGGATTTTTGG + Intergenic
995729783 5:115226199-115226221 CATTTCAGATTTTAGAATTTTGG - Intronic
995738649 5:115330683-115330705 CAACTTTTATTTTAGATTTAGGG - Intergenic
996237174 5:121145056-121145078 CACTCCTGGTTTTTGATTCATGG + Intergenic
996430234 5:123367443-123367465 CACTTTGGATTTTGGATTTTTGG - Intronic
996515615 5:124366116-124366138 GAGATCTGATTTTATATTTAGGG + Intergenic
996703855 5:126477093-126477115 CATTTCAGATTTTGGATTTTTGG - Intronic
997138703 5:131354784-131354806 CATTTCAGATTTCAGATTTTTGG - Intronic
997190454 5:131929536-131929558 CAATTTTTATTTTAGATATAGGG + Intronic
997804041 5:136896314-136896336 CACTTCTCATGTTAGTTTTAGGG + Intergenic
997921779 5:137986925-137986947 CACTTCAGATTTTGGATTTTTGG + Intronic
998042232 5:138958573-138958595 CATTTTGGATTTTAGATTTTTGG - Intronic
998042240 5:138958656-138958678 CACTTTGGATTTTGGATTTTTGG + Intronic
998585084 5:143419090-143419112 CATTTCAGATTTTGGATTTTTGG + Intronic
998618283 5:143765451-143765473 CATTTCTGAATTGAGATTTAAGG - Intergenic
999740613 5:154547594-154547616 CAATTTTTATTTTAGATTCAGGG - Intergenic
999851635 5:155546773-155546795 CATTTTTTATTTTAGATTTGGGG + Intergenic
1000217653 5:159178627-159178649 CATTTTGGATTTTAGATTTTTGG - Intronic
1000368563 5:160513105-160513127 CATTTCAGATTTTAGATTTTTGG - Intergenic
1000489357 5:161890608-161890630 CAAATCTGAGTTTATATTTAAGG - Intronic
1001098237 5:168792804-168792826 CATTTCAGATTTTGGATTTTTGG - Intronic
1001387229 5:171349755-171349777 CAACTTTTATTTTAGATTTAGGG + Intergenic
1001473171 5:172030275-172030297 CAATTCAGATTTTGGATTTTTGG + Intergenic
1002946726 6:1768587-1768609 CATTTCAGATTTCAGATTTTTGG - Intronic
1003484958 6:6567545-6567567 CAACTTTGATTTTAGATTCAGGG + Intergenic
1004317434 6:14602145-14602167 CAGATGTGATTTAAGATTTATGG + Intergenic
1004599911 6:17139008-17139030 CAGCTTTTATTTTAGATTTAGGG - Intergenic
1004611963 6:17250638-17250660 CAACTCTTATTTTAGATTCAGGG + Intergenic
1004780855 6:18906974-18906996 CAATTCTGACTTGACATTTAAGG - Intergenic
1004954202 6:20709334-20709356 CATTTCAGATTTTGGATTTTTGG - Intronic
1004970884 6:20909089-20909111 CACAGATGATTTTAGCTTTAGGG - Intronic
1005597545 6:27393889-27393911 CACTTCAGAGTGTTGATTTAGGG + Intronic
1005737437 6:28761390-28761412 CAATTTTTATTTTAGATTTGGGG - Intergenic
1006318146 6:33303009-33303031 CATTTCAGATTTTAGAGTTTTGG - Intronic
1006962533 6:37948467-37948489 AACTTTTGTTTTTAGACTTAGGG + Intronic
1008306384 6:49906582-49906604 CATTTCTCCTTTTAGATTTAGGG - Intergenic
1008450628 6:51646540-51646562 CCCTTTTGATTTCAGTTTTAAGG - Intronic
1008698060 6:54064718-54064740 TACTTCTGAGTTTAGGTTTGGGG + Intronic
1008756421 6:54799819-54799841 CTTTTCAGATTTTAGATCTATGG - Intergenic
1009318751 6:62257976-62257998 CATTTCAGATTTTGGATTTTTGG - Intronic
1009480036 6:64145531-64145553 CACTTGTGATTTTTCATATATGG - Intronic
1009553757 6:65134735-65134757 CTCTTTTTATTTTAGATTCAGGG - Intronic
1009591984 6:65684703-65684725 CACCTTTTATTTTAGGTTTAAGG + Intronic
1009636580 6:66273065-66273087 CATTTCAGATTTGAGATTTTTGG + Intergenic
1009792124 6:68417240-68417262 CAACTTTTATTTTAGATTTAGGG + Intergenic
1010081320 6:71867345-71867367 CACTTGTGTTTTGAGATTTCAGG + Intergenic
1010656287 6:78515259-78515281 CTCTTTGGATTTCAGATTTATGG + Intergenic
1010724581 6:79318829-79318851 CATTTCTAACTTTTGATTTAAGG + Intergenic
1010895104 6:81352024-81352046 CAACTTTGATTTTATATTTAGGG + Intergenic
1011723395 6:90182899-90182921 CAATTTTTATTTTAGATTCAGGG + Intronic
1011994053 6:93562819-93562841 CACTTCTGAGATTAGGTTTTAGG + Intergenic
1012727129 6:102828253-102828275 CATTTCAGATTTTGGATTTTTGG - Intergenic
1012834042 6:104242522-104242544 CAACTTTGATTTTAGATTCAGGG - Intergenic
1013052585 6:106550993-106551015 CAACTCTTATTTTAGATTCAGGG + Intronic
1013870317 6:114750604-114750626 TACTTCTAATTTTAGGTTCAGGG + Intergenic
1013897234 6:115103443-115103465 CAACTCTTATTTCAGATTTAGGG - Intergenic
1014273759 6:119364074-119364096 CATTTCGGATTTTAGATTTTTGG + Intergenic
1014296985 6:119630674-119630696 CAACTTTTATTTTAGATTTAGGG + Intergenic
1014480529 6:121930592-121930614 CACTATTTCTTTTAGATTTAAGG + Intergenic
1015524595 6:134163917-134163939 CAATTTTTATTTTAGATTCAGGG + Intergenic
1015672482 6:135706110-135706132 CCATTTTTATTTTAGATTTAGGG + Intergenic
1016471945 6:144383828-144383850 CAATTCTGATTCTAGAATTCAGG + Intronic
1017247756 6:152245563-152245585 CCCTTGTCCTTTTAGATTTATGG - Intronic
1018073585 6:160189109-160189131 CACTCCTGGTTTTAGAATTGAGG - Intronic
1018587393 6:165376740-165376762 CATTTCTTATTTTAGAGATAGGG - Intronic
1018840806 6:167514936-167514958 CATTTCTGATTTCAGATTTACGG + Intergenic
1018934646 6:168265737-168265759 CACTTTTGCCTTTAGATTTGGGG - Intergenic
1020396102 7:7720378-7720400 CACTTCTGATTTTATAGGTTTGG + Intronic
1020666011 7:11044993-11045015 CACTTCAGATTTTGGATTTTTGG + Intronic
1020935254 7:14455999-14456021 CATTTCGGATTTTGGATTTTTGG - Intronic
1021130625 7:16908391-16908413 CACTTTGGATTTTGGATTGATGG + Intergenic
1021304727 7:19018841-19018863 CATTTCTGATTTTAGTTATTTGG - Intergenic
1021321874 7:19222640-19222662 CAATTTTAATTTTAGATTTTGGG + Intergenic
1021383703 7:20001727-20001749 CAACTTTGATTTTAGATTCAGGG - Intergenic
1021699826 7:23307174-23307196 CACTACTGATTTTAGAGAAATGG - Intronic
1021811899 7:24410513-24410535 CATTTCAGATTTTGGATTTTTGG - Intergenic
1021832793 7:24633644-24633666 CATTTTGGATTTTAGATTTTTGG + Intronic
1022043210 7:26600652-26600674 CGCTACTGATTTTGGATGTAAGG + Intergenic
1022150042 7:27593162-27593184 CATTTCGGATTTCAGATTTTTGG - Intronic
1022150346 7:27596787-27596809 CATTTCAGATTTTGGATTTTTGG - Intronic
1022206488 7:28169156-28169178 CACTTCAGATGTTAGAATAAAGG - Intronic
1022570805 7:31452072-31452094 CATGTCTGATTTCAGATTTATGG + Intergenic
1022941097 7:35240208-35240230 CATTTCAGATTTTAGATTTGTGG - Intronic
1023028876 7:36076034-36076056 CACTTTGGATTTTGGATTTTTGG - Intergenic
1023168719 7:37369339-37369361 CATTTCAGATTTCAGATTTTTGG - Intronic
1023283584 7:38595576-38595598 CATTTTTAATTTTAGATTCAGGG + Intronic
1023407519 7:39850299-39850321 CATTTCTGATTTTGGAATTTTGG - Intergenic
1023441506 7:40189412-40189434 TACTTTTTATTTTAGATTCAGGG + Intronic
1023958590 7:44908044-44908066 CATTTCCGATTTTGGATTTTTGG + Intergenic
1024320069 7:48056612-48056634 CATTTCGGATTTTGGATTTTTGG + Intronic
1024558504 7:50623959-50623981 CATTTCAGATTTCAGATTTTTGG + Intronic
1024902952 7:54343084-54343106 CAATTCAGATTTTGGATTTTTGG + Intergenic
1024923996 7:54593262-54593284 TACTTCTTATTAAAGATTTATGG - Intergenic
1025095731 7:56094043-56094065 CACATCTGATGTAAGATTAAAGG - Intergenic
1025830740 7:65047012-65047034 CATTTCAGATTTTGGATTTTTGG - Intergenic
1025917905 7:65880928-65880950 CATTTCAGATTTTGGATTTTCGG - Intronic
1025972788 7:66343538-66343560 CAATTTTTATTTTAGATTCAGGG - Intronic
1026334758 7:69384099-69384121 GACTTCTGAGTTGAGCTTTATGG - Intergenic
1026559854 7:71439657-71439679 CACATTTTATTTTAAATTTAAGG + Intronic
1026633837 7:72063693-72063715 CATTTCTGATTTCAGATTTTAGG - Intronic
1026633846 7:72063776-72063798 CATTTCAGATTTTGGATTTTGGG + Intronic
1027289671 7:76692115-76692137 CACTTTGGATTTCAGATTTTTGG - Intergenic
1027741025 7:82005132-82005154 CACTTCTGACTTTGATTTTAAGG - Intronic
1027784012 7:82556449-82556471 TAGTTCTGTTTTTAGATTTTTGG - Intergenic
1028158583 7:87460294-87460316 CAATTTTTATTTTAGATTCAGGG + Intronic
1028229860 7:88294134-88294156 CATTTCTGATTTTATATTTTTGG - Intronic
1028278048 7:88882991-88883013 CAATTTTCATTTTAGATTCAGGG - Intronic
1028514772 7:91665048-91665070 CACTCCTGGGTTTAGATTTGGGG - Intergenic
1028729734 7:94131959-94131981 CACATCTGATTTAAGATGAAAGG - Intergenic
1028974965 7:96902590-96902612 CAATTTTTATTTTAGATTTGGGG + Intergenic
1029852407 7:103476856-103476878 CACTTCTTATTTCAGTTATAAGG - Intronic
1029881439 7:103815406-103815428 CACTTATGATTTTAAATCTGAGG - Intronic
1030433256 7:109480498-109480520 CATTTCTGATTTTAAATTCTGGG + Intergenic
1030801203 7:113855016-113855038 CATTTCAGATTTCAGATTTTTGG - Intergenic
1031735387 7:125353131-125353153 CAATTTTTATTTTAGATTCAAGG - Intergenic
1031928434 7:127660670-127660692 CATTTCAGATTTTGGATTTTTGG + Intronic
1033036601 7:137881292-137881314 CATTTTAGATTTTAGATTTTCGG - Intronic
1033117785 7:138640898-138640920 CAACTCTTATTTTAGATTCAGGG - Intronic
1033412891 7:141135992-141136014 CATTTCTGATTTTATTTATATGG - Intronic
1033667296 7:143453601-143453623 CAATTTTTATTTTAGATTCAGGG - Intergenic
1034024138 7:147679851-147679873 CAATCCTGATTTTAGATTTGGGG - Intronic
1037849568 8:22315833-22315855 CATTTTGGATTTTAGATTTCTGG + Intronic
1038350102 8:26768491-26768513 CATTTCGGATTTCAGATTTTCGG - Intronic
1038732908 8:30143149-30143171 CAATTTTTATTTTAGATTCAAGG - Intronic
1039055244 8:33531151-33531173 CAATTCAGATTTAAGATTTCAGG + Intergenic
1039090808 8:33827759-33827781 CAACTTTTATTTTAGATTTAGGG - Intergenic
1039139423 8:34368995-34369017 CAGATTTTATTTTAGATTTAGGG - Intergenic
1039563144 8:38529076-38529098 ATCTTCTGCTTTCAGATTTAAGG + Intergenic
1039684736 8:39786282-39786304 CAACTTTTATTTTAGATTTAGGG - Intronic
1040045918 8:42963360-42963382 CATTTCTGAGTTTGGATTTTTGG + Intronic
1040066365 8:43147921-43147943 CAATTTTTATTTTAGATTCAGGG - Intronic
1040485198 8:47864523-47864545 CACTTCTTATTACTGATTTAAGG + Intronic
1040690492 8:49931540-49931562 CAACTTTTATTTTAGATTTAGGG - Intronic
1040875992 8:52152785-52152807 CACTTCTTATTTTATAGTAAAGG - Intronic
1040971848 8:53143666-53143688 CATTTCAAATTTTAGATTTTGGG - Intergenic
1041146996 8:54887441-54887463 CAACTTTTATTTTAGATTTAAGG + Intergenic
1041460107 8:58101991-58102013 CCCTTCAAATTTTAGATGTAGGG - Intronic
1042094941 8:65204275-65204297 CAACTTTTATTTTAGATTTAGGG - Intergenic
1042223920 8:66500532-66500554 TTTTTCTTATTTTAGATTTAGGG + Intronic
1042477892 8:69269713-69269735 CATTTCAGATTTCAGATTTTCGG + Intergenic
1042637080 8:70889409-70889431 CACCTTTTATTTTAGATTCAGGG + Intergenic
1042843662 8:73149099-73149121 TACATTTGATTGTAGATTTAGGG - Intergenic
1042843702 8:73149435-73149457 CATATTTGATTGTAGATTTAGGG - Intergenic
1042843708 8:73149483-73149505 CATATTTGATTGTAGATTTAGGG - Intergenic
1042974220 8:74447425-74447447 CACTTCAGATTTCAGTTTTCCGG - Intronic
1043239051 8:77908159-77908181 AAATTCTGATTTTCAATTTAGGG + Intergenic
1043269875 8:78319047-78319069 CATTTCAGATTTTGGATTTTTGG - Intergenic
1043616923 8:82136975-82136997 CACTTCACGTTTTAGAATTATGG + Intergenic
1043651990 8:82607794-82607816 CAACTTTTATTTTAGATTTAGGG + Intergenic
1043841130 8:85106169-85106191 CACTTTTTATTTTAGATTCGGGG - Intergenic
1043989276 8:86732893-86732915 CAGTTTTTATTTTAGATTCAGGG + Intronic
1043993323 8:86782265-86782287 CATTTCAGATTTTGGATTTTTGG + Intergenic
1044009134 8:86970461-86970483 CAATTTTTATTTTAGATTTAGGG + Intronic
1044036650 8:87312083-87312105 CAACTCTCATTTTAGATTCAGGG - Intronic
1044067755 8:87719674-87719696 CAATTCTTATTTTAGGTTCAGGG - Intergenic
1045668681 8:104521185-104521207 CACTTCAGATTTTTGGTTTTGGG - Intronic
1045888972 8:107131778-107131800 CAACTTTTATTTTAGATTTAGGG - Intergenic
1045902716 8:107303225-107303247 CACTTCTGGTTTTACCTTTTTGG + Exonic
1046661557 8:116952877-116952899 CAATTTTTATTTTAGATTCAGGG + Intronic
1046801177 8:118429334-118429356 TACTTCAGATTTTAAATTTTTGG + Intronic
1046838743 8:118832615-118832637 AACTTCTTTTTTTAGGTTTAGGG - Intergenic
1046975763 8:120275356-120275378 CATTTCAGGTCTTAGATTTAAGG - Intronic
1047175713 8:122538435-122538457 CCCTTCTGGTTTTAGATTTCAGG - Intergenic
1047294625 8:123560052-123560074 CATTTCAGATTTTGGATTTTTGG + Intergenic
1047432094 8:124801456-124801478 CAGTTTTTATTTTAGATTTGGGG - Intergenic
1047575991 8:126155802-126155824 CAACTTTTATTTTAGATTTAGGG - Intergenic
1047751998 8:127888841-127888863 CACTTATGATCTTACATTTCTGG - Intergenic
1047813332 8:128434369-128434391 CAACTTTTATTTTAGATTTAGGG - Intergenic
1047887138 8:129264039-129264061 CAATTTTTATTTTAGATTCAGGG + Intergenic
1048259005 8:132929854-132929876 CATCTTTGATTTTAGATTTAGGG + Intronic
1048726392 8:137390119-137390141 CATTTATGATTTATGATTTATGG - Intergenic
1048754317 8:137719146-137719168 CAATTTTTATTTTAGATTCAGGG - Intergenic
1050013177 9:1206095-1206117 CACCTTTTATTTTAGATTTAGGG - Intergenic
1050166263 9:2768095-2768117 CACTAGTGATTTTATTTTTATGG - Intronic
1050389720 9:5128225-5128247 GACTTCTGATTTTGGGTTGAAGG + Intergenic
1050453875 9:5813559-5813581 CATTTCTGATTTTGGATTTTAGG - Intronic
1050724143 9:8627378-8627400 CACTACTTATTTTTGATGTAAGG - Intronic
1051098581 9:13495115-13495137 CAACTTTTATTTTAGATTTAGGG + Intergenic
1051472433 9:17460735-17460757 CTTTTCTGTTTTTAGACTTAAGG - Intronic
1051634223 9:19166943-19166965 CAACTTTTATTTTAGATTTAGGG + Intergenic
1052586669 9:30438134-30438156 CAATTTTTATTTTAGATTCAGGG - Intergenic
1052727095 9:32242146-32242168 CAATTTTTATTTTAGATATAGGG - Intergenic
1053264705 9:36702515-36702537 CATTTCAGATTTCAGATTTTTGG + Intergenic
1053341651 9:37341048-37341070 CACTTCTTATTTTATTTTAAAGG - Intronic
1053609358 9:39695685-39695707 CACATCTGATTGAAGATTTGAGG - Intergenic
1053867199 9:42451956-42451978 CACATCTGATTGAAGATTTGAGG - Intergenic
1054088957 9:60775803-60775825 CACATCTGATTGAAGATTTGAGG + Intergenic
1054244166 9:62646712-62646734 CACATCTGATTGAAGATTTGAGG + Intergenic
1054558291 9:66681260-66681282 CACATCTGATTGAAGATTTGAGG + Intergenic
1054825013 9:69565161-69565183 CACTTCACATTTTAGATGTTTGG - Intronic
1054930797 9:70633298-70633320 CTCTTCTGAGTTTAGTTTTCAGG + Intronic
1055048596 9:71956668-71956690 CATTTCAGATTTCAGATTTTTGG + Intronic
1055148687 9:72967778-72967800 AAATTTTTATTTTAGATTTAGGG + Intronic
1055359005 9:75468805-75468827 CTCTTTTAATTTTTGATTTATGG + Intergenic
1055743883 9:79421457-79421479 CATTTCTGATTTTATTTATAGGG + Intergenic
1055876607 9:80950695-80950717 CATTTTTGATTTTTGATTTTTGG - Intergenic
1056405626 9:86271528-86271550 CATTTCAGATTTCAGATTTTTGG + Intronic
1056663046 9:88558772-88558794 CACTTCTGACATTAGATGTGTGG - Intronic
1057714804 9:97484037-97484059 CATTTCTGATTATTTATTTACGG + Intronic
1057859800 9:98631930-98631952 CACTACTGATTTCAGACTTGAGG + Intronic
1058129887 9:101239496-101239518 CAACTGTTATTTTAGATTTAGGG - Intronic
1059519929 9:114931600-114931622 CACTTCAGGTTTTAGCTTTCAGG - Intergenic
1059526248 9:114993312-114993334 CACTTCTGATTTTCTTTTTGTGG + Intergenic
1059740400 9:117144319-117144341 CATTTCGGATTTCAGATTTTCGG - Intronic
1061941711 9:133887436-133887458 CATTGCTGTTTTTAGAGTTAGGG - Intronic
1185809522 X:3093264-3093286 CACCTTTTATTTTAGATTCAGGG + Intronic
1186117311 X:6318440-6318462 CAATTTTTATTTTAGATTCAGGG - Intergenic
1187991823 X:24882331-24882353 CAACTTTTATTTTAGATTTAGGG + Intronic
1188018642 X:25133368-25133390 CATTTCAGATTTCAGATTTTTGG + Intergenic
1188140880 X:26549186-26549208 CACTTTGTATTTTAGATTAAGGG - Intergenic
1188420941 X:29990217-29990239 CACTTCTGATTTTATTTGTTTGG + Intergenic
1188522871 X:31058236-31058258 CATTTCAGATTTCAGATTTTTGG - Intergenic
1188583438 X:31743824-31743846 CAACTTTGATTTTAGATTCAGGG - Intronic
1188636515 X:32438654-32438676 CTCTTCTGGTTTTAGAGTTAGGG - Intronic
1188712952 X:33424575-33424597 CCATTATGATTTTAGATTGAGGG - Intergenic
1189749940 X:44210689-44210711 CATTTCAGATTTTATATTTAGGG - Intronic
1189929564 X:45994520-45994542 CATTTCTGATTTTATATATTTGG + Intergenic
1190097887 X:47496979-47497001 CCATACTGATTTTAGATTTCTGG - Intergenic
1190704886 X:53019266-53019288 CACTTCTGATGCCAGATTTGTGG - Intergenic
1191661947 X:63660529-63660551 CAATTTTTATTTTAGCTTTAGGG - Intronic
1192289061 X:69772494-69772516 CAATTTTCATTTTAGATTCAGGG + Intronic
1192530420 X:71878044-71878066 CACCTCTGATTTTATATATTTGG - Intergenic
1193343113 X:80374942-80374964 CATTTCAGATTTCAGATTTTTGG + Intronic
1194046856 X:89017983-89018005 CAGTTCTTATTTTCAATTTAGGG - Intergenic
1194369073 X:93048084-93048106 CATTTCTTATTTTAAGTTTAGGG - Intergenic
1194473104 X:94322211-94322233 CAAATTTTATTTTAGATTTAGGG + Intergenic
1194770989 X:97904544-97904566 CACTTCTGATTTTGGTCTTAGGG + Intergenic
1195158965 X:102153081-102153103 CATTTCAGATTTCAGATTTCTGG - Intergenic
1195418697 X:104648719-104648741 CACTTTTGATTTTATCTTAATGG + Intronic
1195472702 X:105250067-105250089 CACTTATGGTTTCACATTTAAGG - Intronic
1195623479 X:106983137-106983159 CACTTCCGATTTTAGATTTTTGG + Intronic
1195699076 X:107688843-107688865 CATTTCAGATTTCAGATTTTTGG - Intergenic
1195699081 X:107688919-107688941 CATTTCAGATTTAAGATTTTTGG + Intergenic
1196318566 X:114260387-114260409 CATTTCAGATTTTGGATTTGGGG + Intergenic
1196500918 X:116380822-116380844 TACTTGTGTTTTTATATTTAAGG + Intergenic
1196608293 X:117681125-117681147 CACTTTTTATTTTAGTTTCAGGG - Intergenic
1196902314 X:120397436-120397458 CACTTCTGCTATCAGATATATGG + Intergenic
1197576263 X:128215526-128215548 TACTTCTGATTTTAGAGGGATGG - Intergenic
1198558301 X:137819701-137819723 CAACTTTTATTTTAGATTTAAGG - Intergenic
1199052526 X:143253478-143253500 CAACTTTTATTTTAGATTTAGGG + Intergenic
1199114752 X:143978206-143978228 CAGTTCTGATTTCATTTTTAGGG + Intergenic
1199322832 X:146461576-146461598 CAAGTTTGATTTTAGATTCAGGG - Intergenic
1199635232 X:149807055-149807077 CACTTCTGTTTCTAGATCTTAGG + Intergenic
1200036195 X:153333020-153333042 CAACTTTCATTTTAGATTTAGGG - Intergenic
1200677278 Y:6164418-6164440 CAATTCTTATTTTAAGTTTAGGG - Intergenic
1201164522 Y:11196503-11196525 CATTTCGGATTTCAGATTTTTGG + Intergenic
1201402951 Y:13622566-13622588 CACGTCTCATTTTACATTGATGG + Intergenic
1201525773 Y:14932499-14932521 CAACTTTTATTTTAGATTTAGGG + Intergenic
1202171410 Y:22048519-22048541 CACTTTTGATCTTACATTAAAGG - Intergenic
1202219952 Y:22537853-22537875 CACTTTTGATCTTACATTAAAGG + Intergenic
1202323164 Y:23657813-23657835 CACTTTTGATCTTACATTAAAGG - Intergenic
1202547608 Y:26012241-26012263 CACTTTTGATCTTACATTAAAGG + Intergenic