ID: 1122620962

View in Genome Browser
Species Human (GRCh38)
Location 14:103057473-103057495
Sequence CTGCGGCGGCGGCGGCGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2680
Summary {0: 2, 1: 17, 2: 233, 3: 618, 4: 1810}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122620962_1122620971 -7 Left 1122620962 14:103057473-103057495 CCTCCCCGCCGCCGCCGCCGCAG 0: 2
1: 17
2: 233
3: 618
4: 1810
Right 1122620971 14:103057489-103057511 GCCGCAGACTAGGAGCGGCGAGG 0: 1
1: 0
2: 0
3: 5
4: 70
1122620962_1122620973 16 Left 1122620962 14:103057473-103057495 CCTCCCCGCCGCCGCCGCCGCAG 0: 2
1: 17
2: 233
3: 618
4: 1810
Right 1122620973 14:103057512-103057534 AGCCTAGCGCTGCGCAAGCCCGG 0: 1
1: 0
2: 0
3: 7
4: 75
1122620962_1122620975 20 Left 1122620962 14:103057473-103057495 CCTCCCCGCCGCCGCCGCCGCAG 0: 2
1: 17
2: 233
3: 618
4: 1810
Right 1122620975 14:103057516-103057538 TAGCGCTGCGCAAGCCCGGCCGG 0: 1
1: 0
2: 0
3: 3
4: 30

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122620962 Original CRISPR CTGCGGCGGCGGCGGCGGGG AGG (reversed) Intergenic
Too many off-targets to display for this crispr