ID: 1122626231

View in Genome Browser
Species Human (GRCh38)
Location 14:103086731-103086753
Sequence CTAAGGCTGCGACCCTGTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122626231_1122626238 28 Left 1122626231 14:103086731-103086753 CCTACACAGGGTCGCAGCCTTAG No data
Right 1122626238 14:103086782-103086804 CCCAGCCATTCTCCTTGTTGGGG No data
1122626231_1122626235 26 Left 1122626231 14:103086731-103086753 CCTACACAGGGTCGCAGCCTTAG No data
Right 1122626235 14:103086780-103086802 AGCCCAGCCATTCTCCTTGTTGG No data
1122626231_1122626236 27 Left 1122626231 14:103086731-103086753 CCTACACAGGGTCGCAGCCTTAG No data
Right 1122626236 14:103086781-103086803 GCCCAGCCATTCTCCTTGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122626231 Original CRISPR CTAAGGCTGCGACCCTGTGT AGG (reversed) Intergenic