ID: 1122627276

View in Genome Browser
Species Human (GRCh38)
Location 14:103091037-103091059
Sequence CCGCTTCAGTTTTAAACCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122627266_1122627276 26 Left 1122627266 14:103090988-103091010 CCCAATGCGGGAAAGGTGGGAGG No data
Right 1122627276 14:103091037-103091059 CCGCTTCAGTTTTAAACCGCAGG No data
1122627264_1122627276 28 Left 1122627264 14:103090986-103091008 CCCCCAATGCGGGAAAGGTGGGA No data
Right 1122627276 14:103091037-103091059 CCGCTTCAGTTTTAAACCGCAGG No data
1122627265_1122627276 27 Left 1122627265 14:103090987-103091009 CCCCAATGCGGGAAAGGTGGGAG No data
Right 1122627276 14:103091037-103091059 CCGCTTCAGTTTTAAACCGCAGG No data
1122627262_1122627276 29 Left 1122627262 14:103090985-103091007 CCCCCCAATGCGGGAAAGGTGGG No data
Right 1122627276 14:103091037-103091059 CCGCTTCAGTTTTAAACCGCAGG No data
1122627268_1122627276 25 Left 1122627268 14:103090989-103091011 CCAATGCGGGAAAGGTGGGAGGT No data
Right 1122627276 14:103091037-103091059 CCGCTTCAGTTTTAAACCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122627276 Original CRISPR CCGCTTCAGTTTTAAACCGC AGG Intergenic
No off target data available for this crispr