ID: 1122628371

View in Genome Browser
Species Human (GRCh38)
Location 14:103096004-103096026
Sequence CCTTATTTGCAGGGGCTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122628363_1122628371 26 Left 1122628363 14:103095955-103095977 CCAAATGTTGAGGAGTAAGAATG No data
Right 1122628371 14:103096004-103096026 CCTTATTTGCAGGGGCTGGAAGG No data
1122628362_1122628371 30 Left 1122628362 14:103095951-103095973 CCAGCCAAATGTTGAGGAGTAAG No data
Right 1122628371 14:103096004-103096026 CCTTATTTGCAGGGGCTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122628371 Original CRISPR CCTTATTTGCAGGGGCTGGA AGG Intergenic
No off target data available for this crispr