ID: 1122628991

View in Genome Browser
Species Human (GRCh38)
Location 14:103098936-103098958
Sequence GGGCCCAGCAGGCACCTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122628984_1122628991 15 Left 1122628984 14:103098898-103098920 CCTCTGGGAACCTCAAGGAAGGT No data
Right 1122628991 14:103098936-103098958 GGGCCCAGCAGGCACCTTGCTGG No data
1122628987_1122628991 5 Left 1122628987 14:103098908-103098930 CCTCAAGGAAGGTAGGTAGGCTG No data
Right 1122628991 14:103098936-103098958 GGGCCCAGCAGGCACCTTGCTGG No data
1122628982_1122628991 18 Left 1122628982 14:103098895-103098917 CCGCCTCTGGGAACCTCAAGGAA No data
Right 1122628991 14:103098936-103098958 GGGCCCAGCAGGCACCTTGCTGG No data
1122628979_1122628991 30 Left 1122628979 14:103098883-103098905 CCAGCTGCTTAGCCGCCTCTGGG No data
Right 1122628991 14:103098936-103098958 GGGCCCAGCAGGCACCTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122628991 Original CRISPR GGGCCCAGCAGGCACCTTGC TGG Intergenic
No off target data available for this crispr