ID: 1122629305

View in Genome Browser
Species Human (GRCh38)
Location 14:103099970-103099992
Sequence GTCTCAGGAAAGGCTCCTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 250}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122629302_1122629305 -8 Left 1122629302 14:103099955-103099977 CCTTTTTGGGGGATGGTCTCAGG 0: 1
1: 0
2: 0
3: 22
4: 166
Right 1122629305 14:103099970-103099992 GTCTCAGGAAAGGCTCCTGATGG 0: 1
1: 0
2: 0
3: 16
4: 250
1122629301_1122629305 -7 Left 1122629301 14:103099954-103099976 CCCTTTTTGGGGGATGGTCTCAG 0: 1
1: 0
2: 1
3: 15
4: 184
Right 1122629305 14:103099970-103099992 GTCTCAGGAAAGGCTCCTGATGG 0: 1
1: 0
2: 0
3: 16
4: 250
1122629293_1122629305 20 Left 1122629293 14:103099927-103099949 CCGAGTGACGGTGGGCACCTGCG 0: 1
1: 0
2: 0
3: 6
4: 61
Right 1122629305 14:103099970-103099992 GTCTCAGGAAAGGCTCCTGATGG 0: 1
1: 0
2: 0
3: 16
4: 250
1122629298_1122629305 3 Left 1122629298 14:103099944-103099966 CCTGCGGAGACCCTTTTTGGGGG 0: 1
1: 0
2: 3
3: 18
4: 223
Right 1122629305 14:103099970-103099992 GTCTCAGGAAAGGCTCCTGATGG 0: 1
1: 0
2: 0
3: 16
4: 250

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122629305 Original CRISPR GTCTCAGGAAAGGCTCCTGA TGG Intergenic
900480816 1:2898294-2898316 GTCCCAGGAAAAGCTGCTGCCGG + Intergenic
902173840 1:14634704-14634726 GGCTTTGGAGAGGCTCCTGAGGG + Intronic
902622902 1:17660688-17660710 GTCTCAGCAAAGGCACCTTCAGG - Intronic
902904204 1:19542601-19542623 GTCCCAGGTCAGGCCCCTGATGG - Intergenic
903448690 1:23438171-23438193 GAATCAGGAAAGGCTCCTGGAGG - Intronic
903942371 1:26940625-26940647 AACTCAGGAAAGGCTTGTGAGGG + Intronic
905880803 1:41462709-41462731 GTCTCAGGGAAGACTCCTATTGG + Intergenic
907476776 1:54711085-54711107 GTGTCAGATAAGGCTTCTGAGGG + Intronic
908902006 1:68966396-68966418 GACACAGGAAAAGCTCCTTAGGG + Intergenic
911095095 1:94048384-94048406 CTGTCAGGAAAGGCTTCTGATGG + Intronic
912615955 1:111100337-111100359 GTGTTAGGTAAGTCTCCTGAAGG + Intergenic
912775612 1:112504703-112504725 ATCTCAGGAAAGGCGTCTCAGGG + Intronic
915286603 1:154857336-154857358 GGCTGAGGAAAGTCTCCTGTGGG - Intronic
917913460 1:179676248-179676270 GTGTTAGGCAAGTCTCCTGAAGG + Intronic
919179104 1:194058825-194058847 GTCTCAGGAGAGGGACCTGGTGG - Intergenic
919810355 1:201405407-201405429 GTCTGAGGAAAGAGACCTGATGG + Exonic
921130845 1:212218305-212218327 GAGTCAGGAAAGGCTCCCTAAGG - Intergenic
923195937 1:231667361-231667383 GGCTCAGGAAAGGTCACTGAAGG - Intronic
924102468 1:240618905-240618927 TTCTCAGGAATGGGTCCTGTGGG - Intergenic
1063393202 10:5663563-5663585 GTCTCAGTTAAGGGACCTGAGGG + Intronic
1070541065 10:77415713-77415735 TCCTCAGCAAAGGCTCCTGCAGG + Intronic
1070722557 10:78766698-78766720 GTCTCAGGAAAAGCTCTAGCTGG + Intergenic
1071338090 10:84618179-84618201 GTGTCAGGAAAGGCTTCCTAAGG + Intergenic
1071338311 10:84620360-84620382 GTGTCAGGAAAGGCTTCCTAAGG - Intergenic
1074095868 10:110311961-110311983 TGCTCATGAAAGGCTCCTGGTGG + Intergenic
1075850239 10:125580848-125580870 GTCCCAGGAAAGGACTCTGATGG - Intronic
1076982126 11:210165-210187 ACCTCAGGAAAGGCTTCTGAGGG + Intronic
1077013249 11:388858-388880 CTGTCTGGAAAGCCTCCTGAAGG - Intergenic
1078042050 11:7875749-7875771 GTCTCTGGAAATGCTTCTAAGGG + Intergenic
1078665174 11:13318660-13318682 ATCTGAGGAAAGACTCCAGAAGG - Intronic
1080237581 11:30089728-30089750 TTCTCAGGAAAACCTCCTTACGG + Intergenic
1081476021 11:43432211-43432233 GTCAAAGTAAAGTCTCCTGACGG - Intronic
1083899484 11:65636683-65636705 ATCTCAGGTAAGGCACCTGTGGG + Exonic
1086989480 11:93287501-93287523 GCCTAAGGAAAGGCTCCTGGAGG + Intergenic
1087262017 11:96022266-96022288 GTCTCAGGAAAGATTCAGGACGG - Intronic
1087728494 11:101751639-101751661 TTCTAAGGAAAGCCTCATGAAGG - Intronic
1088400907 11:109422276-109422298 GTGTGAGTAAAGGCTTCTGATGG + Intronic
1088410973 11:109534238-109534260 GTGTCAGGAAAGGGACCAGAAGG - Intergenic
1089012970 11:115145503-115145525 GTCCCTGGAAAGGCTGCTGTGGG - Intergenic
1089523432 11:119080974-119080996 GTCCCTGGTAAGGCCCCTGAAGG - Intronic
1090163317 11:124518290-124518312 GTCTCTGGCAATGGTCCTGAGGG - Intergenic
1091395037 12:149213-149235 GTCTCAGGAGGTGCTGCTGACGG - Intronic
1091659593 12:2373476-2373498 GTCCCAGGGCAGGCTCCTCAGGG - Intronic
1091827429 12:3523394-3523416 ATCTCAGGAAGGGATCCTGTAGG + Intronic
1092010102 12:5102616-5102638 GTCTAAGTAAAGGCCCATGAAGG + Intergenic
1093995158 12:25632914-25632936 GTGTTAGGCAAGTCTCCTGAAGG - Intronic
1094446614 12:30537885-30537907 GTTTCTGGAATAGCTCCTGAAGG + Intergenic
1095153292 12:38820895-38820917 GTCTCATGAAAGAAACCTGAAGG + Intronic
1100290805 12:93213144-93213166 GTGTTAGGCAAGTCTCCTGAAGG + Intergenic
1102709708 12:114915374-114915396 GTCTCAGGGTCGGCTCCTGGAGG - Intergenic
1106485775 13:30171394-30171416 GTCTCAGGCAAGGCTGCTGCTGG - Intergenic
1108596438 13:51954085-51954107 GAATCAGGAAAGGCTTCTGGAGG + Intronic
1116805461 14:49490159-49490181 GTCTCAGAAGGGGCTACTGAGGG - Intergenic
1117819671 14:59634776-59634798 GTTTCAGGAAAGGCTTTAGAGGG + Intronic
1118714283 14:68548233-68548255 GTCCCAGGCAGGGGTCCTGATGG - Intronic
1119130515 14:72168329-72168351 GGCTCAGGAAAGGCTCCTTCAGG + Intronic
1119599080 14:75962612-75962634 GACACAGGAAAGGCTTCAGAAGG - Intronic
1120374135 14:83678639-83678661 GTGTCAGGAAAGGGACCTGGTGG - Intergenic
1121411103 14:93748776-93748798 TTCTCAGGCTCGGCTCCTGAGGG + Intronic
1122077580 14:99246021-99246043 GCCTCGGGACCGGCTCCTGAAGG - Intronic
1122444238 14:101757640-101757662 GACGCAGGAAGGGCTTCTGAGGG + Intergenic
1122629305 14:103099970-103099992 GTCTCAGGAAAGGCTCCTGATGG + Intergenic
1123129591 14:105974491-105974513 GTCTCAGGGAAGGGTCCAGGTGG - Intergenic
1123129642 14:105974735-105974757 GTCTCAGGGAAGGGTCCACATGG - Intergenic
1123579697 15:21704624-21704646 GTCTCAGGGAAGGGTCCACATGG - Intergenic
1123579856 15:21705352-21705374 GTCTCAGGGAAGGGTCCACATGG - Intergenic
1123579877 15:21705463-21705485 GTCTCAGGGAAGGGTCCACATGG - Intergenic
1123616324 15:22147135-22147157 GTCTCAGGGAAGGGTCCACATGG - Intergenic
1123616483 15:22147863-22147885 GTCTCAGGGAAGGGTCCACATGG - Intergenic
1123616504 15:22147974-22147996 GTCTCAGGGAAGGGTCCACATGG - Intergenic
1123616525 15:22148085-22148107 GTCTCAGGGAAGGGTCCACATGG - Intergenic
1125573732 15:40740639-40740661 GTCTCAGAAAAGGCTGCAAACGG + Intronic
1127946893 15:63764534-63764556 GTCTCAGGAAATACTCCCCATGG + Intronic
1128905776 15:71466523-71466545 GACTCAAGGAAGGCTCCTGAGGG - Intronic
1129097399 15:73223674-73223696 GTGTCAGGTGAGTCTCCTGAAGG + Intronic
1129302555 15:74633952-74633974 GTCTCGGGCCAGGCTCCTGTGGG - Intronic
1129891903 15:79077097-79077119 GTTCCAGAAAAGGCTCCTTATGG - Intronic
1131483861 15:92804190-92804212 ATCTCAGCAAAGGCCACTGAGGG + Intronic
1131999596 15:98165277-98165299 GTCTCTGGAAGGTCTCCTGCTGG + Intergenic
1132280874 15:100613936-100613958 GTGTCAGGAAATACTCCAGAAGG - Intronic
1202988567 15_KI270727v1_random:438869-438891 GTCTCAGGGAAGGGTCCACATGG - Intergenic
1202988726 15_KI270727v1_random:439597-439619 GTCTCAGGGAAGGGTCCACATGG - Intergenic
1202988747 15_KI270727v1_random:439708-439730 GTCTCAGGGAAGGGTCCACATGG - Intergenic
1132535180 16:475518-475540 GTCTCTGGAAAGGCAGGTGATGG + Intronic
1133776223 16:8897364-8897386 TTCTCAGGAAATGGTCCCGAGGG + Intronic
1135776706 16:25262923-25262945 GTCCCCGGAAAGGCTCCCCAGGG + Intergenic
1136612049 16:31372217-31372239 GTGTCAGGGAGGCCTCCTGAAGG + Intronic
1138294189 16:55872773-55872795 GTGTCAGGGAAGGGTGCTGAGGG - Intronic
1139432107 16:66916359-66916381 GACTCAGGCAAGGCAACTGAGGG - Exonic
1141030208 16:80581134-80581156 GGATCAGGGAAGGCTCCTGGCGG + Intergenic
1141727925 16:85801988-85802010 GTTTCAGGGAAGGCTTCTGGAGG + Intronic
1142365290 16:89646866-89646888 GGGGCAGGAAAGGCTCCTGGTGG - Intronic
1144156557 17:12509473-12509495 GTATCAGGACATGCTCCTGTGGG - Intergenic
1144656401 17:17040038-17040060 GCTTCAGGGAAGGCTCCTGGAGG - Intergenic
1146605058 17:34250949-34250971 GGCCCAGGGAAGGCTCGTGATGG - Intergenic
1146629302 17:34458516-34458538 GTCTCAGGGAAGGCGGGTGAGGG - Intergenic
1147650941 17:42061744-42061766 GCAGCAGGAAAGTCTCCTGAAGG - Intronic
1148189607 17:45669322-45669344 GACTCAGAGAAGGCTCCTGGAGG + Intergenic
1151585393 17:75005336-75005358 GTCTCAGGAAGGGCGGCAGAAGG - Exonic
1152023219 17:77792710-77792732 GTGTCAGGACAGCCTCCTCACGG - Intergenic
1152035124 17:77867622-77867644 ACCACAGGAAAGGCTCCTGCCGG + Intergenic
1152705567 17:81841803-81841825 GTCACAGGCAGGGCTCCTCAAGG + Intergenic
1153568656 18:6446118-6446140 ATCTCAGGAAAGGCTCTGCAGGG - Intergenic
1153758503 18:8307353-8307375 GTCTCAAGAAAGGGTCCAGTTGG - Intronic
1156012719 18:32513100-32513122 GTCTCAGGAGGAGCTCCTGGAGG - Intergenic
1158830468 18:61272013-61272035 GACTCAGGAACAGCTGCTGATGG + Intergenic
1160107717 18:75994067-75994089 GTCTGAGGACAGGCTCAGGATGG - Intergenic
1160746791 19:715475-715497 TTCTCAGAAAAGGTTCATGATGG - Intronic
1163124711 19:15238691-15238713 GTCTAAGGATTAGCTCCTGAGGG - Intronic
1163367178 19:16881702-16881724 GTCTCAGGAACCCCTACTGAGGG + Intergenic
1164526799 19:29018940-29018962 GTCTGAGGAAAGGTGCCTGGGGG + Intergenic
1164667614 19:30051918-30051940 GCCTCAGAGAAGGCTCCTGCAGG + Intergenic
1166076283 19:40415403-40415425 AACTCAGGAAAGGATCCTGCAGG + Intergenic
1166910874 19:46155495-46155517 GTCTCAGGAAATTGTCCTAAGGG - Intronic
1167750420 19:51376103-51376125 CTCTCAGGAAAAGCTTCAGAAGG - Intergenic
1168508385 19:56955153-56955175 CTGTCAGAAAAGGCTCCTCATGG + Intergenic
925418748 2:3693162-3693184 GTCTCTGGAAATGGTCCTAAGGG - Intronic
928896128 2:36265959-36265981 GTCTCTGGAAAGGATCCTAAGGG + Intergenic
930544347 2:52747459-52747481 ATCTCAGTAAAGGCTTGTGAAGG + Intergenic
931091002 2:58886005-58886027 GTCACAGGGAAGACTGCTGACGG - Intergenic
933648034 2:84828165-84828187 AACACAGGAAATGCTCCTGAAGG - Intronic
935858853 2:107305165-107305187 GTCTCAAGAAAGGTCGCTGAGGG - Intergenic
937549568 2:123070284-123070306 GACTCAGGAAGGTCTCCTGGTGG + Intergenic
937875869 2:126824929-126824951 GCCACAGGAAAGGCCCTTGAGGG - Intergenic
940618488 2:156082009-156082031 GTGTTAGGTAAGTCTCCTGAAGG + Intergenic
941588404 2:167388410-167388432 GTCTCCAGGAAGGCTCCTGGAGG + Intergenic
944431841 2:199642573-199642595 GTGTTAGGTAAGTCTCCTGAAGG + Intergenic
945131876 2:206582437-206582459 GTGTCAGGTGAGTCTCCTGAAGG + Intronic
945212080 2:207394298-207394320 TAGTCAGGAAGGGCTCCTGAGGG + Intergenic
947787574 2:232837435-232837457 GTCTCTGGAAATACTCCTAAGGG - Intronic
947915844 2:233831133-233831155 GTCCCAGGCAGGGCTGCTGAGGG + Intronic
947976635 2:234372187-234372209 TTCTCAGGTGAGGCTCCTGCAGG + Intergenic
948245773 2:236484704-236484726 GTCTCAGGGACTGCTACTGAGGG - Intronic
948660210 2:239502256-239502278 GCCACAGGAGAGGGTCCTGAAGG - Intergenic
1169274250 20:4222209-4222231 GACTCAGCCAAGGCTACTGAAGG - Intronic
1169291818 20:4359328-4359350 GTTTTAGGAAATGTTCCTGAGGG - Intergenic
1169748952 20:8972212-8972234 GTCTCAGCAATGTCTACTGATGG + Intergenic
1171299778 20:24050210-24050232 GTCTCAGAATATGCTCCTGGAGG + Intergenic
1175426000 20:58867394-58867416 GTCTTTGGAAATGTTCCTGATGG + Intronic
1175567385 20:59991202-59991224 GAATTAGGAAAGGCTCCTGTTGG - Intronic
1177205854 21:18010355-18010377 AACTCAGGAAAGTCTCCTGGTGG + Intronic
1177922431 21:27169302-27169324 GTGTCAGGCAAGTCCCCTGAAGG - Intergenic
1178942816 21:36921556-36921578 GGCTCAGGAAAGCCTCATGGTGG + Intronic
1180414305 22:12694068-12694090 GGCTCACGAAAGCCCCCTGAGGG + Intergenic
1184160470 22:42694434-42694456 GTCTAAGGACAGGCCACTGAGGG + Intronic
1184185701 22:42863664-42863686 GTGTCAGGAAAGGAACCTGGTGG + Intronic
1184345152 22:43908715-43908737 GTCTCCAGAAAGGCTCCAGGTGG - Intergenic
1184655652 22:45940779-45940801 CTCTCAGGAAGGGATGCTGAAGG + Intronic
1185228279 22:49666051-49666073 TTCTCAGGAAAGTTTCATGAAGG - Intergenic
1185237895 22:49725276-49725298 GTCTGAGGACTGGCTGCTGATGG + Intergenic
950425128 3:12921045-12921067 GTCTCAGCCATGGCTACTGAGGG + Intronic
950646165 3:14378111-14378133 GCCCCAGGCAAGCCTCCTGATGG + Intergenic
950947141 3:16960747-16960769 GTATATGGAAAGGCTTCTGAGGG - Intronic
952308497 3:32166866-32166888 GCCTCAGGAAAGGCTGCACATGG - Exonic
953495337 3:43381311-43381333 GTGTCAGGTGAGTCTCCTGAAGG - Intronic
954426594 3:50446657-50446679 GTCTGAGAAAAAGCTCTTGATGG - Intronic
954939015 3:54353848-54353870 GCCTCAGGAAAGGCCCCTCAGGG + Intronic
956036829 3:65102456-65102478 GTGTCAGGGAAGGGACCTGATGG + Intergenic
958754383 3:98233509-98233531 GTGTCAGGGAAGGGACCTGATGG + Intergenic
960776049 3:121254617-121254639 TTCTCAGAAAAGTCTCATGAAGG - Intronic
962001993 3:131307261-131307283 GGCTCAGTAAAGGATACTGAAGG - Intronic
962191961 3:133319839-133319861 GTCTCATGAAGGACTCATGAAGG - Intronic
962909282 3:139833044-139833066 GAGTCAGGAAAGTCTTCTGAAGG - Intergenic
963081360 3:141397473-141397495 TTGTAAGGAAAAGCTCCTGAAGG - Intronic
964601051 3:158501746-158501768 GTGTTAGGTAAGTCTCCTGAAGG + Intronic
965814610 3:172623860-172623882 GAGTTAGGAAAGGCTCCTGGAGG + Intergenic
966217555 3:177519058-177519080 GTGTCAGGAAAGGGGCCTGGTGG - Intergenic
967801868 3:193670816-193670838 GTCTCAGGAGAGGCTCTTCCAGG + Intronic
968523869 4:1046422-1046444 GGCTCGGGAAAGGCTCGGGAAGG - Intergenic
968831679 4:2935333-2935355 GTCCCAGGACAGGCGGCTGAGGG + Intergenic
969904498 4:10381702-10381724 GTCATGGGAAAGGGTCCTGATGG + Intergenic
974995780 4:69157123-69157145 ATCTCAGGAAAGGCTGCAAAGGG + Intronic
975008852 4:69323504-69323526 ATCTCAGGAAAGGCTGCAAAGGG + Intronic
975517490 4:75262419-75262441 GTGTTAGGCAAGTCTCCTGAAGG - Intergenic
976260496 4:83140670-83140692 GACTCAGGAATGGCTGCTGGAGG + Intergenic
976727129 4:88225664-88225686 GAGTCATGACAGGCTCCTGATGG + Intronic
977168514 4:93730790-93730812 GTTTCAGCAGAGGCACCTGAAGG + Intronic
977283443 4:95070589-95070611 GGCTCAGGAAAGGATACTGTAGG + Intronic
983029307 4:162779666-162779688 TTCTCAGGAGAGGCCACTGAGGG + Intergenic
983830382 4:172319821-172319843 GTCTCTGGAAATGGTCCTAAAGG + Intronic
985268470 4:188172441-188172463 GTCTCAGAAAATCCTGCTGAAGG + Intergenic
985970642 5:3375586-3375608 GTCTCAGGGTTGGCTTCTGAGGG + Intergenic
986380456 5:7180368-7180390 GTCTCAGGAATAGCTGCTGATGG - Intergenic
988286837 5:29229522-29229544 TTCTAATGAGAGGCTCCTGATGG + Intergenic
989665892 5:43853409-43853431 GTCACATCAAAGGCTCCTCACGG - Intergenic
989992284 5:50781650-50781672 GTCTAAGGACAAGCTACTGAGGG - Intronic
990014397 5:51041311-51041333 GTCTCTGGGATGGCTCCAGAAGG - Intergenic
991501812 5:67284321-67284343 GTCCCTGGAAAGGCACCAGAAGG + Intergenic
993360427 5:86968225-86968247 GTCTCAGGAAAGATTCCATATGG + Intergenic
994846237 5:104992147-104992169 TTCACAAGAAAGGCTGCTGAAGG + Intergenic
996325552 5:122268612-122268634 GTCTCTAGAAAGGCTGCGGAAGG - Intergenic
997241982 5:132314387-132314409 CTCCCAGGAAAAGCTGCTGAGGG - Intronic
997872027 5:137514733-137514755 ATCTCAGGCAAGGCCCCTGATGG + Intronic
998585044 5:143418666-143418688 GGGTCAGGGAAGGCTCCTGGAGG + Intronic
1002280429 5:178126758-178126780 CTCACAGGAAAGGATACTGAAGG + Intergenic
1003338307 6:5195742-5195764 GTCTCAGAAATGGCTCCTTCAGG + Intronic
1003582212 6:7350002-7350024 GTGTTAGGTAAGTCTCCTGAAGG - Intronic
1006087056 6:31603531-31603553 GTCTCAAGAAAGAGGCCTGAGGG - Intergenic
1008635671 6:53408038-53408060 TTCTCTGGAAAGGCTTCTGTGGG + Intergenic
1011327345 6:86163708-86163730 GTGTTAGGAGAGTCTCCTGAAGG - Intergenic
1011538349 6:88402753-88402775 GTCACAGAAAAAGCTCTTGATGG + Intergenic
1011893109 6:92192283-92192305 GTGTTAGGCAAGTCTCCTGAAGG + Intergenic
1013168584 6:107616150-107616172 TGCACAGGAAAGGCTCCAGAGGG - Intronic
1013940880 6:115660402-115660424 GTGTTAGGTGAGGCTCCTGAAGG - Intergenic
1018773979 6:166998058-166998080 GCCACAGGAAAGGCTCCTTCGGG - Intergenic
1019014106 6:168867377-168867399 GTCTGAGGGCAGGCCCCTGATGG - Intergenic
1020003028 7:4766339-4766361 GTCTCTGGATAGGGACCTGAGGG - Exonic
1020246652 7:6434703-6434725 GTTTCAGTAAATGCTTCTGATGG - Intronic
1020489570 7:8763320-8763342 GTCTCAGGAAATGCTTCTAGGGG + Intergenic
1020722807 7:11769529-11769551 GTCTCAAGAAAGGGTCCTTAGGG + Intronic
1022581018 7:31554286-31554308 TTCTCAGGAAAGGCTGATCATGG + Intronic
1022972954 7:35533981-35534003 GTGTCAGGAGAGGGGCCTGATGG + Intergenic
1026742252 7:72986190-72986212 GTCTCAGGAAAGGCAGATGGGGG - Intergenic
1026802099 7:73406610-73406632 GTCTCAGGAAAGGCAGATGGGGG - Intergenic
1027028375 7:74870929-74870951 GTCTCAGGAAAGGCAGATGGGGG - Intergenic
1027101483 7:75378888-75378910 GTCTCAGGAAAGGCAGATGGGGG + Intergenic
1028151683 7:87380965-87380987 ACATCAGGAAAGGCTCTTGAGGG - Intronic
1029203406 7:98854200-98854222 GCCTCAGAAAAGGCTTTTGAAGG + Intronic
1029217883 7:98964788-98964810 GTCTGAGGAAAGGCCCCCGGTGG - Intronic
1029271546 7:99380038-99380060 GTCTCAGTGATGGCTCCTGGGGG - Intronic
1030517520 7:110556958-110556980 GTTTCTGGGAGGGCTCCTGATGG + Intergenic
1031327050 7:120414838-120414860 GAATCAGGAAAGGCCCATGATGG - Intronic
1032844692 7:135742439-135742461 GTCTCAGGAAAGGCTTCCTGGGG - Intronic
1033259178 7:139827356-139827378 GTGTCAGGTGAGTCTCCTGAAGG + Intronic
1034023206 7:147668418-147668440 GCTTCTGGAATGGCTCCTGAAGG - Intronic
1034679785 7:152919877-152919899 GTCACAGGAAAGAGACCTGAGGG - Intergenic
1038681048 8:29668504-29668526 GTTTCCGGAATGGCTCCTCAGGG - Intergenic
1039571413 8:38589556-38589578 TTCTAAGGAAATGGTCCTGATGG + Intergenic
1039659851 8:39449825-39449847 GTCTCAGGAAAGGCTGCAAGGGG + Intergenic
1039919686 8:41884505-41884527 GACTCAGGAAAGCTTCCTGGAGG + Intronic
1040434879 8:47380515-47380537 GGCTCAAGAAAGGCACCTGCCGG - Intronic
1040448684 8:47522444-47522466 GCAGCAGGAAAGGCTGCTGAAGG + Intronic
1041332288 8:56739891-56739913 CTCTCAGGGCTGGCTCCTGACGG + Intergenic
1044555874 8:93561347-93561369 TTCTCAGGAATGGCTCCTAAGGG + Intergenic
1045692883 8:104777826-104777848 GTCTCAGGATCTGCTTCTGAGGG - Intronic
1045827978 8:106423794-106423816 CTCTCAGCAGAGGCTCCTGAAGG - Intronic
1046691932 8:117295366-117295388 GAATCAGGTAAGGCTTCTGAGGG - Intergenic
1047561617 8:125992702-125992724 GTCTCAGGAAGGGATCCCGTGGG + Intergenic
1049207061 8:141368515-141368537 GACTCAGGGAAGGCTCCCCAAGG + Intergenic
1049545820 8:143230047-143230069 GTCTCAGGAAAGCGTCCCTAGGG - Intergenic
1055461862 9:76527306-76527328 GTCTCAGGGAAGGCCACAGAAGG + Intergenic
1056105120 9:83339618-83339640 GGGTCAGGGAAAGCTCCTGAAGG - Intronic
1056519440 9:87386614-87386636 CTCTCAGGAAAGGCTGTTGTGGG - Intergenic
1056528875 9:87469600-87469622 GTCTCAGGAAAGGCCTCTAGGGG - Intergenic
1056534718 9:87517332-87517354 GTCTCAGGAATGCCTTCAGAGGG - Intronic
1057793944 9:98142678-98142700 GACTCAGGGAAGGCGCCTTAGGG + Intronic
1059696220 9:116732702-116732724 GTCTCAGGAAAGCCTGCAAAAGG + Intronic
1060047230 9:120350547-120350569 GTGTTAGGAAAGGCTTCTGGAGG + Intergenic
1060802469 9:126553457-126553479 GGATCAGGGAAGGCTCCTGGGGG + Intergenic
1061297213 9:129683182-129683204 GTCCCAGGAGGGGTTCCTGATGG - Intronic
1061400852 9:130367591-130367613 GGCTCAATAAAGGCTACTGAAGG - Intronic
1062004773 9:134233653-134233675 GCGAGAGGAAAGGCTCCTGACGG - Intergenic
1185746885 X:2580836-2580858 GTTCCAGGAAAGCATCCTGAGGG + Intergenic
1186220861 X:7347841-7347863 GTCTCCAAAAAGGCTTCTGAAGG + Intronic
1186528261 X:10269510-10269532 TGCTCAGGAAAGGATACTGAAGG - Intergenic
1187281991 X:17864460-17864482 GTCTCAGGATATGCTTCTGGGGG - Intergenic
1189741033 X:44117387-44117409 GTCTCAGGATTTGCTTCTGAGGG - Intergenic
1189931909 X:46021334-46021356 GTGTTAGGTAAGTCTCCTGAAGG - Intergenic
1191786475 X:64921903-64921925 GTCAGAGGAAAGGCACCTGAAGG - Exonic
1194586995 X:95747522-95747544 TTCTCCGGAATGACTCCTGAAGG - Intergenic
1194723823 X:97371532-97371554 GTATCAGAAGAGGTTCCTGAGGG + Intronic
1195284271 X:103368002-103368024 GCCTCTGGAAATGCTCCTAAGGG - Intergenic
1196161513 X:112489254-112489276 GTCTTAGGTGAGTCTCCTGAAGG - Intergenic
1199280388 X:145993733-145993755 GTATCAGGAAAGGTACCTCAAGG + Intergenic
1199280563 X:145995237-145995259 GTCTCAGGGAAGGTACCTGAAGG + Intergenic
1199521312 X:148739528-148739550 GTCTTAGGTGAGTCTCCTGAAGG + Intronic
1199976058 X:152895532-152895554 GTCTAAGGGAAGGTTCATGAAGG + Intergenic