ID: 1122630388

View in Genome Browser
Species Human (GRCh38)
Location 14:103104903-103104925
Sequence GTCTGCGTAGGGACCTGATT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 47}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122630377_1122630388 12 Left 1122630377 14:103104868-103104890 CCTGGCCGGGTGCGCTCTGCAGG 0: 1
1: 0
2: 0
3: 15
4: 190
Right 1122630388 14:103104903-103104925 GTCTGCGTAGGGACCTGATTGGG 0: 1
1: 0
2: 0
3: 4
4: 47
1122630381_1122630388 7 Left 1122630381 14:103104873-103104895 CCGGGTGCGCTCTGCAGGTGGGA 0: 1
1: 0
2: 1
3: 16
4: 140
Right 1122630388 14:103104903-103104925 GTCTGCGTAGGGACCTGATTGGG 0: 1
1: 0
2: 0
3: 4
4: 47
1122630374_1122630388 29 Left 1122630374 14:103104851-103104873 CCTCAGTAGGGGAGCGACCTGGC 0: 1
1: 0
2: 0
3: 2
4: 98
Right 1122630388 14:103104903-103104925 GTCTGCGTAGGGACCTGATTGGG 0: 1
1: 0
2: 0
3: 4
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122630388 Original CRISPR GTCTGCGTAGGGACCTGATT GGG Intronic
901397449 1:8991782-8991804 TTCTGGGGTGGGACCTGATTGGG - Intergenic
903374869 1:22859416-22859438 GTCTGCTTGGGGAGCTGATGTGG + Intronic
917693662 1:177495637-177495659 CTCTGTGCAGGGACCTGCTTTGG + Intergenic
1069333524 10:67321534-67321556 GTCTGTGTTGGGATCTGATGTGG - Intronic
1073133106 10:101203386-101203408 GTCTGGGTAGGGACCCCTTTCGG + Intergenic
1077793699 11:5468856-5468878 GTCTGCATGCAGACCTGATTCGG - Intronic
1083663744 11:64263889-64263911 GACTGAGTAGGGAACTGAGTAGG + Intronic
1100283629 12:93142220-93142242 GTCTACATAGGAACCTGCTTTGG - Intergenic
1104436982 12:128764517-128764539 GTCTGCATAGGGATGTTATTTGG + Intergenic
1105482788 13:20794295-20794317 GTCTGCGATGGGGCCTGAGTGGG + Intronic
1107333121 13:39323118-39323140 GGCTGCTTGGGGACATGATTAGG - Intergenic
1114173331 14:20296291-20296313 GTTTGCATAGGGACAAGATTGGG - Intronic
1122630388 14:103104903-103104925 GTCTGCGTAGGGACCTGATTGGG + Intronic
1132069880 15:98766963-98766985 GTCAGCGTAGGGACCAGGCTCGG + Intronic
1151720799 17:75855003-75855025 GTCTGCATGGGGACCTGGTATGG - Intronic
1151915985 17:77118325-77118347 CTCTCCGAAGGGACCTGACTGGG - Intronic
1158704440 18:59779129-59779151 TTCTTCTTAGGGAGCTGATTTGG - Intergenic
1162731658 19:12722111-12722133 GTGTGTGTAGGGGCCTGTTTCGG - Intronic
1166121135 19:40687521-40687543 GTCTGCGGTGGGAACTGAGTGGG - Intronic
1168114162 19:54211710-54211732 GTCAGTGAAGGGACCTGTTTGGG - Intronic
925873815 2:8294438-8294460 GTCTGCTTAGGGACATGAGATGG + Intergenic
937252032 2:120530356-120530378 CTCTGCGTAGGGCTCTGAGTGGG - Intergenic
938221128 2:129568934-129568956 GTCTGCTTCTGGAGCTGATTTGG + Intergenic
947295016 2:228621299-228621321 GTCTGCTGAGGGAGCTGTTTTGG + Intergenic
947308571 2:228775201-228775223 GTCTGCAAGGGGACCTGCTTTGG + Intergenic
947441574 2:230126626-230126648 AACTGAGTAGGGACCAGATTGGG - Intergenic
1175835978 20:61994709-61994731 GTCAGGGTAGTGACCTGATGAGG - Intronic
1183915766 22:41117519-41117541 GACTGCGTAGGACCCTGATTTGG - Exonic
1184859330 22:47164326-47164348 GTCTTGTTAGGGAACTGATTTGG + Intronic
962934178 3:140064187-140064209 GTCTGAGGAGGGAAGTGATTTGG - Intronic
964385539 3:156143696-156143718 CTCTGAGTAGGGAGGTGATTTGG + Intronic
968748336 4:2372618-2372640 TTCTGGGAAGGGACCTGATGAGG + Intronic
968754871 4:2409961-2409983 TTCTGCGTAGGCAGCTGACTTGG - Intronic
972357496 4:38294273-38294295 ATCTGCACATGGACCTGATTTGG + Intergenic
975599018 4:76080040-76080062 GTCTGCTTAGGGACCTCAGTTGG - Intronic
980093982 4:128470882-128470904 GGCTGGGAAGGGATCTGATTCGG + Intergenic
990237286 5:53781801-53781823 GTGTGGGTAGGGACCTATTTTGG - Intergenic
993875093 5:93297210-93297232 GTCTGCAAAGTGACCTGATTTGG + Intergenic
1002792294 6:445466-445488 CTCTGCTTAGGGCCCTGGTTTGG + Intergenic
1006240431 6:32673079-32673101 GTCTCAGTAGGGACTTTATTTGG - Intergenic
1007227536 6:40325532-40325554 GCCTGGTTAGGGACCTGGTTGGG + Intergenic
1017254056 6:152313389-152313411 GACTTCGTAGGGGCCTGAATAGG - Intronic
1027144719 7:75686530-75686552 GTCAGCGCAGGGAGCTTATTTGG + Intronic
1027829219 7:83155850-83155872 GTCTGGGTAGGACCCTGAATTGG + Exonic
1035795992 8:2357078-2357100 GTCTTTGAAGGGATCTGATTTGG - Intergenic
1049422159 8:142521829-142521851 TTCTGCCTGGGGACCTGGTTGGG + Intronic
1054998623 9:71422888-71422910 GTCTGTGTAGGGAGCTGATAAGG - Intronic
1055426264 9:76200119-76200141 TGCTGTGTAGGGAACTGATTAGG - Intronic
1058177270 9:101750994-101751016 GTCTGCTTAGGGAAATAATTTGG + Intergenic
1062267593 9:135694435-135694457 GTCTGCGTTGGGGTCTGATGTGG - Exonic
1189037121 X:37505110-37505132 GTCTGCGAAGGGACCGGAAGTGG - Intronic
1198482764 X:137056107-137056129 GTCTGCTTTTGGACCTGTTTGGG - Intergenic