ID: 1122630449

View in Genome Browser
Species Human (GRCh38)
Location 14:103105148-103105170
Sequence GGGAGTGCGCGCGCGTGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 270}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122630444_1122630449 -5 Left 1122630444 14:103105130-103105152 CCGGGAACCTGGATGGAGGGGAG 0: 1
1: 0
2: 3
3: 33
4: 364
Right 1122630449 14:103105148-103105170 GGGAGTGCGCGCGCGTGGAGGGG 0: 1
1: 0
2: 1
3: 15
4: 270
1122630436_1122630449 16 Left 1122630436 14:103105109-103105131 CCAGCAGGGGGCGCGCGAGCGCC 0: 1
1: 0
2: 11
3: 48
4: 222
Right 1122630449 14:103105148-103105170 GGGAGTGCGCGCGCGTGGAGGGG 0: 1
1: 0
2: 1
3: 15
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122630449 Original CRISPR GGGAGTGCGCGCGCGTGGAG GGG Intronic
901783409 1:11609091-11609113 AGGAGTGCGAGCGCATGGTGCGG + Intergenic
903750343 1:25617249-25617271 GGGTGTGCGCGCGCTCGGGGCGG + Intergenic
904470364 1:30732175-30732197 GGGGGTGGGCGTGTGTGGAGGGG + Intergenic
904641869 1:31937690-31937712 GGGAGTGGGAGCGCGTCGGGAGG - Intronic
905685056 1:39901928-39901950 GGGAGGGCGCGCGCGCGGGGGGG - Exonic
907222977 1:52921105-52921127 GGGCGGGCGCGCGGCTGGAGAGG + Intronic
907427827 1:54392021-54392043 TGGAGTGGGCGCGGGAGGAGAGG - Intronic
907920041 1:58903738-58903760 GGCAGTGCCCGCGGGAGGAGCGG + Intergenic
908401102 1:63773903-63773925 GGGAGGGTGCGGGCGTTGAGAGG + Intergenic
914428380 1:147599541-147599563 GGGAGAGTGAGCGCGTGGGGAGG + Intronic
914702870 1:150150120-150150142 GGGAGGGCGCGAGGGAGGAGCGG + Exonic
917859726 1:179134729-179134751 GGGAGAGGGCGACCGTGGAGAGG - Intronic
918995793 1:191757538-191757560 GTGTGTGCGCGCGCGTGGGTGGG - Intergenic
919631011 1:199959995-199960017 AGGAGTGCAGGCTCGTGGAGCGG + Intergenic
920731303 1:208488423-208488445 AGGAGTGCGAGCGCGTGGCACGG - Intergenic
921944905 1:220879790-220879812 GTGGGTGGGCGCGCGGGGAGGGG - Exonic
922790202 1:228306985-228307007 GGGCGGGTGCGAGCGTGGAGTGG + Exonic
922855860 1:228774079-228774101 AGGAGTGCGAGCGCATGGCGTGG + Intergenic
1063085051 10:2809231-2809253 GGGAGAGAGAGCGAGTGGAGAGG - Intergenic
1065099739 10:22321337-22321359 GGGGGAGGGCGCGCGCGGAGGGG - Exonic
1065204545 10:23344324-23344346 GGGAGCACGCGCGGGAGGAGGGG + Intronic
1070800680 10:79243026-79243048 GGGAGGGCGCGCGCGAGCCGGGG + Intronic
1071997567 10:91163008-91163030 GCGAGCGCGCGCGCGTGGGGCGG - Intronic
1074088497 10:110226472-110226494 GGGAGCGCGCGTGAGGGGAGGGG + Intronic
1074088585 10:110226787-110226809 GGGAGCGCGCGTGAGGGGAGGGG + Intronic
1074088628 10:110226943-110226965 GGGAGCGCGCGCGTGAGGGGAGG + Intronic
1075733458 10:124649973-124649995 GGGAGTGAGCCTGCGAGGAGAGG - Intronic
1077103029 11:830521-830543 GGGAGTGGGCCCGGGCGGAGCGG - Intronic
1077475405 11:2787984-2788006 GGCCGTGCGCGCGTGTGGGGAGG + Intronic
1078180085 11:9004058-9004080 GCCAGTGCGCGCGCGGGGGGCGG + Intergenic
1080779767 11:35419414-35419436 GGGTGTGTGCGCGCCTGGGGAGG + Intronic
1081046336 11:38278587-38278609 AGGAGTGCGGGCGTGTGGCGGGG - Intergenic
1081994713 11:47355776-47355798 GCGAGTGTGTGCGCGTGGGGGGG - Intronic
1083747501 11:64744144-64744166 GGGAGTGTACATGCGTGGAGAGG - Intronic
1084319193 11:68364033-68364055 GGGGGTGCGCGGGCGTGGGTGGG + Intronic
1085375954 11:76060940-76060962 AGGAGTGCGGGCGCATGGCGCGG + Intronic
1085863206 11:80257936-80257958 GGGAGTGCAGGCGCATGGCGCGG + Intergenic
1088058207 11:105610481-105610503 GGGAGTGCGCGCTCGAGGAGGGG + Intronic
1091304627 11:134529718-134529740 GGCCGTGCACGCCCGTGGAGAGG + Intergenic
1096435907 12:51591094-51591116 GGCAGGGGGCGCGCGCGGAGGGG + Intronic
1096710628 12:53452625-53452647 GGGAGGGCGCGCGCGCGGTAGGG + Intronic
1096847903 12:54418206-54418228 GGGTGTGTGCGCGCGTGAAGGGG - Intronic
1097190364 12:57216690-57216712 GGGAGGGGGCGCGCGGGGCGCGG + Intergenic
1097716262 12:62969918-62969940 GGGTGTGGGGGCGCGGGGAGGGG + Intergenic
1103800359 12:123533755-123533777 GGGAGGGCGCGCGCGTGCGCAGG + Intergenic
1104749310 12:131228187-131228209 AGGAGTGCGAGCGCATGGCGCGG + Intergenic
1104929376 12:132329787-132329809 GGGCGCGCGGGCGCGGGGAGCGG + Intergenic
1106340259 13:28820286-28820308 GTGAGTGCGGGGGCGCGGAGCGG + Intergenic
1106735670 13:32586290-32586312 GGACGTGCGCGCGCGCGGACGGG + Intergenic
1107770806 13:43786528-43786550 GGGAGTGGGCGAGGGGGGAGGGG - Intronic
1108189915 13:47927743-47927765 GGGACTGAGCACACGTGGAGAGG - Intergenic
1108996069 13:56735938-56735960 AGGAGTGCGGGCGCATGGCGCGG + Intergenic
1113082719 13:106535161-106535183 GGGAGCGCACGCGCGGGGCGCGG + Intergenic
1113820369 13:113209023-113209045 GGGCGCGCGCGCCCGAGGAGGGG + Intronic
1113994132 14:16053047-16053069 GGGATTGCGCACACGTGCAGCGG + Intergenic
1114957790 14:27845635-27845657 GGGAAGGCGCGGGCGGGGAGAGG - Intergenic
1115399268 14:32939220-32939242 GGGTGTGCGTGTGCGTGGGGTGG - Intronic
1115755003 14:36520684-36520706 GGGAGCGCGCGAGCAGGGAGCGG + Intronic
1118777027 14:68979487-68979509 GGGGGTGTGCGCGCCGGGAGGGG - Intergenic
1122630449 14:103105148-103105170 GGGAGTGCGCGCGCGTGGAGGGG + Intronic
1122930969 14:104932990-104933012 GGGAGGGCGCGTGCGGGGCGGGG - Exonic
1123135643 14:106025440-106025462 GGGAGTGGGCACCTGTGGAGAGG + Intergenic
1123151392 14:106185194-106185216 GGGAGTGGGCACCTGTGGAGAGG + Intergenic
1123171551 14:106377592-106377614 GGGAGTGGGCACCTGTGGAGTGG + Intergenic
1123195258 14:106610055-106610077 GGGAGTGGGCACCTGTGGAGAGG + Intergenic
1123581431 15:21718103-21718125 GGGAGTGGGCACCTGTGGAGAGG + Intergenic
1123618080 15:22160726-22160748 GGGAGTGGGCACCTGTGGAGAGG + Intergenic
1125323794 15:38515761-38515783 GGGGGTGCGGGGGCGGGGAGAGG - Intronic
1127142737 15:55993769-55993791 GGGCGGGGGCGCGCGTGGCGGGG + Intergenic
1128071945 15:64802971-64802993 GGGAGTGTGCGGAAGTGGAGAGG - Intergenic
1128374628 15:67066127-67066149 GGGAGGGCGCGCGGGCGGCGAGG - Exonic
1128454214 15:67823530-67823552 GGCTGTGCGCGCGCGCGGGGAGG + Intronic
1128791138 15:70434707-70434729 GCGCGCGCGCGCGGGTGGAGCGG - Intergenic
1129503147 15:76059603-76059625 CTGAGTGCGAGCGTGTGGAGAGG - Intronic
1129644835 15:77420215-77420237 GGGCGAGGGCGCGCGCGGAGGGG - Intergenic
1129741772 15:77992831-77992853 GGGAGTGGGGGGGAGTGGAGTGG - Intronic
1129983550 15:79896714-79896736 GGGCGTGCGCGCGCCGGGAGGGG + Intronic
1129997210 15:80016853-80016875 AGGAGTGCGGGCGCATGGCGGGG + Intergenic
1132318633 15:100909038-100909060 GGGTTTGCACGCGCATGGAGGGG - Intronic
1132580078 16:680685-680707 GTGAGTGCGCCCGCGCGGGGAGG + Intronic
1132599482 16:767528-767550 GGGAGGAGGGGCGCGTGGAGGGG + Intronic
1132877936 16:2148592-2148614 GTGGCTGCGCGCCCGTGGAGCGG + Intronic
1133340666 16:5033677-5033699 GCGCGCGCGCGCGCGTGGATAGG + Exonic
1135304507 16:21356525-21356547 GGAAGTGAGCGCTCCTGGAGGGG - Intergenic
1136301250 16:29335655-29335677 GGAAGTGAGCGCTCCTGGAGGGG - Intergenic
1137707723 16:50547579-50547601 GGGAGGTCGCGCGGGGGGAGGGG - Intergenic
1138229076 16:55324624-55324646 GAGAGTGCGCGCGCGCGCACGGG + Exonic
1139402816 16:66696209-66696231 GGGAGAGGGGGCGCGAGGAGCGG + Intronic
1139549185 16:67664008-67664030 GGGAGTGCGCCCGCAGGAAGTGG + Exonic
1142062948 16:88042391-88042413 GGAAGTGAGCGCTCCTGGAGGGG - Intronic
1142810571 17:2393846-2393868 GGGAGGGCGCGCGTGCGCAGAGG - Intronic
1143127926 17:4656534-4656556 AGGAGTGCGGGCGCATGGCGCGG - Intergenic
1143283431 17:5771592-5771614 AGGAGTGCGGGCGCATGGCGCGG + Intergenic
1145279707 17:21458284-21458306 GGGACTGCGGGAGGGTGGAGAGG + Intergenic
1145925619 17:28644839-28644861 GGGAGGGGGCGCGCGGCGAGGGG - Intronic
1147168680 17:38605987-38606009 GGGCGGGCGCGCGCGCGGCGCGG + Intergenic
1148780497 17:50118494-50118516 GGGAGTGGGCGGGTGTGCAGGGG + Intronic
1152245726 17:79183717-79183739 GCGTGTGCGCGCGTGTGTAGCGG + Intronic
1152581185 17:81166230-81166252 GGGCGGGAGCGCGCGCGGAGCGG + Intergenic
1152655990 17:81519445-81519467 GGGAGATGGCGCCCGTGGAGTGG + Intronic
1152777579 17:82212560-82212582 GGGGTTGCGGCCGCGTGGAGCGG - Intronic
1154354224 18:13612553-13612575 GAGAGTGTGTGAGCGTGGAGGGG - Intronic
1155258086 18:24015273-24015295 GGGACTGCGGGCGCGCGGGGCGG - Intronic
1156171623 18:34493556-34493578 GGGAGGGCGCGGGGGTGGAGGGG + Intronic
1157094955 18:44679513-44679535 GGGAGGGCGCGGGCGCGGAAGGG - Intergenic
1157263890 18:46200086-46200108 GTGTGTGCGCGCGCGTGCTGGGG + Intronic
1158427474 18:57352713-57352735 GTGAGCGCGCGCGCGTGTGGCGG - Exonic
1159102470 18:63971155-63971177 GGGAGAGCGCGCGCGCGAAACGG - Intronic
1160499806 18:79396062-79396084 GGGCGTGTGCGCGCGTGGCGGGG - Intronic
1160548832 18:79680201-79680223 CGGAGCGCGCGGGCGTGGTGCGG + Exonic
1160732155 19:646171-646193 GGGACTTCCCTCGCGTGGAGTGG - Intergenic
1161072793 19:2270872-2270894 GGGAGGGCCCGGGCCTGGAGCGG + Intronic
1161104152 19:2434932-2434954 GTGAGTGCGGGCGCGGGGCGGGG + Intronic
1161115523 19:2494710-2494732 TGGAGTGTGCACTCGTGGAGGGG + Intergenic
1161203694 19:3029366-3029388 GGGGGCGCGGGCGCGGGGAGGGG - Intronic
1162237817 19:9321972-9321994 AGGAGTGCGGGCGCATGGCGCGG + Intergenic
1162632636 19:11941280-11941302 AGGAGTGCGGGCGCATGGCGCGG - Intronic
1163167594 19:15508582-15508604 GGGTGAGTGCGCGCGTGGTGAGG + Exonic
1163202470 19:15778686-15778708 GGGAGTGCGTGAGTGAGGAGGGG + Intergenic
1163202529 19:15779114-15779136 GGGAGTGCGTGAGTGAGGAGAGG + Intergenic
1163398179 19:17076085-17076107 GGGAGTTCGAGGGCGTGGGGGGG + Intronic
1166107015 19:40602458-40602480 GGGAGTGGGGGCCCCTGGAGCGG + Intronic
1166798082 19:45440016-45440038 GGGGGAGCGCGCGGGGGGAGCGG + Intronic
1168694391 19:58396489-58396511 GGCGGTGCGCGCGCGTCGCGGGG - Exonic
928723052 2:34142519-34142541 AGGAGTGCGGGCGCATGGTGTGG - Intergenic
930003469 2:46877732-46877754 GTGAGTGCGTGTGTGTGGAGTGG - Intergenic
930071424 2:47369435-47369457 GGGAGGGCGTGCGCCGGGAGTGG - Exonic
931348972 2:61471286-61471308 GGGTGGGCGAGCGCGCGGAGGGG - Intergenic
931728223 2:65130593-65130615 GGGGGTGCGGGGGCGGGGAGGGG + Intergenic
932625674 2:73293758-73293780 GGGAGCGCGCGCGCACGCAGCGG - Intergenic
935059153 2:99593155-99593177 TGGGGTGCGGGGGCGTGGAGGGG - Intronic
935301665 2:101698150-101698172 GCGAGCGGGCGCGCGGGGAGCGG + Intronic
936865340 2:117071576-117071598 AGGAGTGCACGCCCGTGGTGTGG - Intergenic
938258350 2:129877754-129877776 GGGCGGGCGCGCGTGTGGGGGGG + Intergenic
938258364 2:129877793-129877815 GGGCGGGCGCGCGTGTGGGGGGG + Intergenic
938537522 2:132257823-132257845 GGGATTGCGCGCACGCGCAGCGG - Intronic
938817468 2:134918793-134918815 GGGAGTCCGCGAGCCAGGAGGGG + Intronic
941164897 2:162074187-162074209 GGGAGCAGGCGCGCGTGGCGCGG + Exonic
941476523 2:165957048-165957070 AGGAGTGCGGGCGCGTGGCGCGG - Intergenic
942368593 2:175256985-175257007 AGGAGTGCGGGTGCGCGGAGCGG - Intergenic
945235182 2:207626173-207626195 GGCAGAGCGCGCGGCTGGAGTGG + Intergenic
946029265 2:216692107-216692129 GGGAGTGGGCGCTCCTGGAAAGG - Intronic
946982099 2:225229433-225229455 AGGAGTGCGAGCGCATGGCGCGG - Intergenic
948588469 2:239035550-239035572 GGGGGTGGGCGCGCCTGGCGGGG - Intergenic
948762815 2:240203152-240203174 AGGAGTGCGGGCAGGTGGAGAGG + Intergenic
1168812017 20:710399-710421 GGGCGTGCGCGCGCGTGTCTGGG - Intergenic
1168883245 20:1225597-1225619 GGCAGTGCGCTAGAGTGGAGAGG - Intergenic
1171019484 20:21572217-21572239 GGGAGGGGGCGCGGGTGCAGGGG - Intergenic
1171318784 20:24220706-24220728 AGGAGTGCGAGCGCATGGTGCGG - Intergenic
1171768285 20:29301768-29301790 GGGATTGCGCCCACGTGCAGTGG - Intergenic
1173548143 20:43914792-43914814 GGGACTGCGAGCGCGGGGGGCGG - Intergenic
1173601663 20:44299510-44299532 AGGAGTGCGGGCGCATGGCGTGG + Intergenic
1173778834 20:45736267-45736289 AGGAGTGCGGGCGCATGGCGCGG + Intergenic
1175237551 20:57525148-57525170 GGCAGTGCGCAGGCGCGGAGCGG + Intronic
1175267002 20:57709319-57709341 GGGAGGGCGCGCCCGGGGCGCGG + Intronic
1175429602 20:58891946-58891968 GGGAGCGCGCGCCCGGGGCGGGG - Intronic
1175859795 20:62143931-62143953 GGGCGGGCGCGCGCGGGGACGGG + Intronic
1175866807 20:62183058-62183080 GTGAGTGCGGGAGCGGGGAGCGG + Intronic
1176069833 20:63220360-63220382 TGGAGTGCGCTGACGTGGAGTGG + Intergenic
1176380605 21:6110741-6110763 CCGAGTGCCCGAGCGTGGAGGGG + Intergenic
1179133629 21:38660793-38660815 GGGAATGCACGCGCGTGGCCAGG + Intronic
1179742867 21:43427499-43427521 CCGAGTGCCCGAGCGTGGAGGGG - Intergenic
1180313136 22:11254468-11254490 GGGATTGCGCACACGTGCAGCGG - Intergenic
1182149510 22:28018293-28018315 GTGTGTGCGCGCGCGGGGGGGGG + Intronic
1182638759 22:31750199-31750221 TGGAGTGCGCGCGCGCGGTGCGG - Intergenic
1182804453 22:33058383-33058405 GGGCGCTCGCGCGCGTTGAGGGG - Intergenic
1182804487 22:33058475-33058497 GGGAGTGGGCGCGGGTGGGCGGG - Intergenic
1183788388 22:40045148-40045170 GCGAGGGAGCGCGCGTGGGGCGG + Intronic
1184523190 22:45007695-45007717 GGGTGTGCGAGCGCGGGGAAGGG + Intronic
1184523199 22:45007720-45007742 GGGTGTGCGAGTGCGGGGAGGGG + Intronic
1184808955 22:46815855-46815877 GGGAGAGGGCCTGCGTGGAGGGG + Intronic
1184865411 22:47199406-47199428 GGGAGGGCGCGGGCGTGGCTGGG - Intergenic
950024281 3:9809981-9810003 GGGAGGGCGAGCGCGGCGAGGGG + Exonic
950204786 3:11071204-11071226 AGGAGTGTGGGCGCGTGGTGCGG - Intergenic
951217668 3:20040325-20040347 GGGAGGGCGGGGGCGGGGAGGGG + Exonic
952393775 3:32903169-32903191 AGGAGTGCGAGCGCATGGCGCGG + Intergenic
952398297 3:32940058-32940080 AGGAGTGCGAGCGCATGGCGCGG + Intergenic
954256661 3:49412060-49412082 GTGAGTGCGCGCGCGTGCGCGGG - Exonic
954632664 3:52055751-52055773 GGCAGGCCGAGCGCGTGGAGAGG + Intronic
955356752 3:58238059-58238081 GGCAGCGCCCGCGCGGGGAGCGG - Intronic
955830598 3:62998668-62998690 AGGAGTGCGTGGGAGTGGAGAGG - Intergenic
956246443 3:67187939-67187961 GGGAGTGGGCAGGGGTGGAGTGG - Intergenic
956438886 3:69260628-69260650 AGGAGTGCAGGCGCGTGGTGCGG + Intronic
957074145 3:75588130-75588152 AGGAGTGCGGGCGCATGGTGAGG + Intergenic
962367368 3:134795450-134795472 AGGAGTGTGTGCGCGTGGGGCGG - Exonic
962722381 3:138187729-138187751 GGGAGTGAGCGAGGGTGGAGAGG + Intronic
963397281 3:144750184-144750206 AGGAGTGCGGGCGCATGGCGCGG + Intergenic
966182172 3:177197409-177197431 GGAAGGGCGCGAGCGGGGAGAGG + Intronic
966425408 3:179775503-179775525 AGGAGTGCAGGCGCGTGGCGCGG - Intronic
967305119 3:188052154-188052176 GGGAGTGGGAGGGGGTGGAGGGG + Intergenic
967889070 3:194352069-194352091 GGGTGTGTGCGCGCGTGGGTAGG + Intergenic
968613884 4:1568770-1568792 GGGAGGCGGCGCGGGTGGAGTGG - Intergenic
969307899 4:6336203-6336225 GGGACTGGGGGCGTGTGGAGGGG - Intronic
969795425 4:9524445-9524467 AGGAGTGTGGGCGCATGGAGAGG - Intergenic
971244337 4:24914567-24914589 GGGGGTGGGGGGGCGTGGAGGGG - Intronic
972632899 4:40857241-40857263 GGGAGTGCGGCCGGGTGGGGCGG - Intronic
974147486 4:57965801-57965823 AGGAGTGCGAGCGCATGGTGCGG + Intergenic
974147774 4:57967567-57967589 AGGAGTGCAAGCGCGTGGTGTGG + Intergenic
975710598 4:77157304-77157326 GAGGGTGGGCGCGCGGGGAGCGG + Exonic
976126025 4:81834522-81834544 GGGAGTGGGGGAGGGTGGAGGGG + Intronic
978254814 4:106681432-106681454 AGGAGTGCGGGCGCATGGCGTGG - Intergenic
978754285 4:112285940-112285962 GGGCGGGAGCGCGAGTGGAGCGG - Intronic
980051862 4:128047543-128047565 AGGAGTGCGAGCGCATGGCGTGG - Intergenic
982265661 4:153536222-153536244 GGGAGTGAGGGCCTGTGGAGAGG + Intronic
982769002 4:159378468-159378490 AGGAGTGCAGGCGCGTGGTGTGG + Intergenic
984770632 4:183433521-183433543 AGGAGTGCGAGCGCATGGCGAGG + Intergenic
987896359 5:23951673-23951695 AGGAGTGCGGGCGCGCGGCGCGG + Exonic
988684670 5:33515372-33515394 AGGAGTGCGAGCGCATGGCGTGG - Intergenic
990008732 5:50970134-50970156 GAGTGTGCGTACGCGTGGAGAGG - Intergenic
991371536 5:65925471-65925493 GGGAGTGCGGGGTCGGGGAGCGG + Intergenic
992962679 5:81971912-81971934 GGGACTGGGAGCGGGTGGAGAGG - Intergenic
993519463 5:88883240-88883262 GGGAGCGCGCGCGAGGGGGGGGG + Intronic
995568737 5:113457520-113457542 AGGAGTGCGAGCGCATGGCGTGG + Intronic
997899844 5:137754365-137754387 GAGGGTGCGCGCGCGTTCAGCGG - Exonic
1000665421 5:163989213-163989235 GTGTGTGCGCGCGCGTGTGGGGG + Intergenic
1001841611 5:174881048-174881070 AGGAGTGCGGGCGCATGGCGCGG + Intergenic
1002221807 5:177688611-177688633 AGGAGTGCGAGCGCATGGCGTGG + Intergenic
1003942666 6:11044347-11044369 GGGTGTGCGCGCGCCGGGCGTGG - Intergenic
1005758828 6:28949777-28949799 AGGAGTGCGAGCGCATGGCGTGG - Intergenic
1005851929 6:29828750-29828772 TGGAGGGCACGTGCGTGGAGTGG + Exonic
1005864471 6:29927385-29927407 TGGAGGGCACGTGCGTGGAGAGG + Intergenic
1006043059 6:31271119-31271141 TGGAGGGCACGTGCGTGGAGTGG - Exonic
1006052650 6:31356213-31356235 TGGAGGGCGAGTGCGTGGAGTGG - Exonic
1006271989 6:32972084-32972106 GCGAGCGCGCGCGCGCGGAGGGG + Exonic
1006644906 6:35509305-35509327 GGGAGTGCCTGAGCGTGGAGGGG + Exonic
1006983583 6:38163636-38163658 AGGAGTGCGCAGGAGTGGAGTGG + Intergenic
1010428148 6:75749096-75749118 GGGAGGGCGCGCTCCGGGAGAGG - Intergenic
1010617451 6:78030179-78030201 AGGAGTGCGTGCGCATGGCGCGG + Intergenic
1014055955 6:117015130-117015152 AGGAGTGCGGGCGCATGGCGCGG + Intergenic
1018959980 6:168441266-168441288 GGCTGGGCGGGCGCGTGGAGGGG - Exonic
1019125907 6:169840036-169840058 GGGTGTGGGTGGGCGTGGAGTGG - Intergenic
1019343496 7:519213-519235 GGGAGTGCGCGCCCGCAGCGCGG + Exonic
1022363291 7:29684741-29684763 CCGAGCGCGGGCGCGTGGAGAGG + Intergenic
1022698096 7:32729019-32729041 CCGAGCGCGGGCGCGTGGAGAGG - Intergenic
1023722675 7:43112701-43112723 GCGAGTGTGTGCGCGAGGAGGGG - Exonic
1023812998 7:43926733-43926755 GGGATTGCGCGAGCGCGGGGCGG + Intronic
1024748136 7:52431225-52431247 AGGAGTGCGGGCGCATGGCGCGG - Intergenic
1027868165 7:83673688-83673710 AGGAGTGCGAGCGCATGGCGTGG + Intergenic
1029206100 7:98870122-98870144 GGGAGGACGCGGCCGTGGAGAGG - Intronic
1029449595 7:100633393-100633415 GTGAGTGCGCGCGCGGGCGGGGG - Intronic
1031902935 7:127429541-127429563 AGGAGTGCGGGCGCATGGCGTGG + Intronic
1032013411 7:128360970-128360992 GTGTGCGCGCGCGCGTGCAGGGG - Intronic
1033664036 7:143424381-143424403 AGGAGTGCGAGCGCATGGCGCGG - Intergenic
1035417936 7:158705092-158705114 GGGAGTGCGCGGTCCAGGAGAGG + Intergenic
1036930600 8:12951950-12951972 GGGAGCGCGCGCGCGGGCCGGGG - Intronic
1037450907 8:19014386-19014408 GACAGTGCGTGCGCGGGGAGAGG + Intronic
1037807443 8:22066563-22066585 CGGAGAACGCGCGCGTGGACGGG - Intronic
1037900480 8:22685431-22685453 GCGCGCGCGCGCGCGGGGAGGGG + Intergenic
1037961720 8:23102940-23102962 CTGAGTTCGTGCGCGTGGAGAGG - Exonic
1039595487 8:38787234-38787256 GGGAGTCCGCGAGCCGGGAGCGG + Exonic
1042512506 8:69626468-69626490 AGGAGTGCGAGCGCATGGCGCGG - Intronic
1042560917 8:70071574-70071596 GGGTGTGTGTGCGCGCGGAGGGG - Intronic
1046149282 8:110202559-110202581 AGGAGTGCGGGCGCATGGCGCGG - Intergenic
1049218276 8:141417629-141417651 GGGAGGGCGCGCACCGGGAGAGG + Intronic
1049419444 8:142510510-142510532 GCGCGTGGGCGCACGTGGAGCGG - Intronic
1049744079 8:144255758-144255780 GCGTGTGCACGCGCGTGGTGGGG + Intronic
1051170258 9:14314134-14314156 GCGAGTGCGCGCGGGTGGCGGGG + Intronic
1056687134 9:88776081-88776103 GGGAGTGAGTGCACGTGGTGAGG + Intergenic
1057786059 9:98087992-98088014 GGGCGTGCGCGCGTCTGCAGGGG + Exonic
1058967217 9:110049022-110049044 GGGAGAGGGCCCGGGTGGAGGGG + Intronic
1060283377 9:122228494-122228516 GGGAGCGCGCGCGCGAGCGGGGG - Intronic
1061976101 9:134068537-134068559 GGGAGCGCGCGCGCGGGGCGGGG + Intergenic
1062643225 9:137532889-137532911 GGGAGTGCTCCCGTCTGGAGTGG - Intronic
1062643274 9:137533139-137533161 GGGAGTCCTCCCGCCTGGAGTGG - Intronic
1062643293 9:137533225-137533247 GGGAGTCCTCCCGCCTGGAGTGG - Intronic
1062643305 9:137533268-137533290 GGGAGTCCTCCCGCCTGGAGTGG - Intronic
1062643344 9:137533436-137533458 GGGAGTCCTCCCGCCTGGAGTGG - Intronic
1062643374 9:137533563-137533585 GGGAGTCCTCCCGCCTGGAGTGG - Intronic
1062643459 9:137533940-137533962 GGGAGTCCTCCCGCCTGGAGTGG - Intronic
1062643489 9:137534069-137534091 GGGAGTCCTCCCGCCTGGAGTGG - Intronic
1062643499 9:137534112-137534134 GGGAGTCCTCCCGCCTGGAGTGG - Intronic
1062643531 9:137534239-137534261 GGGAGTGCTCCCGCCTGGAGTGG - Intronic
1062643541 9:137534280-137534302 GGGAGTGCCCCCGTCTGGAGTGG - Intronic
1185747620 X:2584648-2584670 GGGGGCGAGCGCGCGGGGAGGGG + Intergenic
1188095865 X:26020644-26020666 GTGTGTGCGCGCGCGTGCATGGG - Intergenic
1189310604 X:40014818-40014840 GCGCGCGCGCGCTCGTGGAGCGG - Intergenic
1189325192 X:40107414-40107436 GGGAGCGCGCGCGCTTGGGTGGG - Intronic
1192511747 X:71724253-71724275 GGGTGTGTGCGTGCGTGGGGGGG - Intergenic
1192514950 X:71757252-71757274 GGGTGTGTGCGTGCGTGGGGGGG + Intergenic
1195694267 X:107655236-107655258 GCGAGTGTGTGCGCGTGGAGGGG - Intergenic
1196124200 X:112082240-112082262 GGGAGTGGGTGCGCTTGAAGGGG - Exonic
1196582752 X:117395056-117395078 AGGAGTGCGAGCGCATGGTGCGG + Intergenic
1197533721 X:127662998-127663020 AGGAGTGCGGGAGCGTGGGGTGG - Intergenic
1197655141 X:129108646-129108668 GTGTGTGCGCGCGCGCGGCGGGG + Intergenic
1197782488 X:130171888-130171910 GTGCGCGCGCGCGCGTGAAGGGG - Exonic
1200229436 X:154436839-154436861 GGGCGGGCGCGCGCGGGGCGGGG + Intergenic
1201076823 Y:10195632-10195654 GGGATTGCGCGCACGCGCAGTGG + Intergenic