ID: 1122633098

View in Genome Browser
Species Human (GRCh38)
Location 14:103116813-103116835
Sequence GGCCTGCCATGCCAGCACCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122633098_1122633105 10 Left 1122633098 14:103116813-103116835 CCCAGGTGCTGGCATGGCAGGCC No data
Right 1122633105 14:103116846-103116868 GTGCGGACAGCCCAGCCCAAGGG No data
1122633098_1122633104 9 Left 1122633098 14:103116813-103116835 CCCAGGTGCTGGCATGGCAGGCC No data
Right 1122633104 14:103116845-103116867 CGTGCGGACAGCCCAGCCCAAGG No data
1122633098_1122633102 -7 Left 1122633098 14:103116813-103116835 CCCAGGTGCTGGCATGGCAGGCC No data
Right 1122633102 14:103116829-103116851 GCAGGCCATGGCGGCGCGTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122633098 Original CRISPR GGCCTGCCATGCCAGCACCT GGG (reversed) Intergenic
No off target data available for this crispr