ID: 1122633702

View in Genome Browser
Species Human (GRCh38)
Location 14:103120195-103120217
Sequence AAAACACTTAGAACAACGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122633698_1122633702 19 Left 1122633698 14:103120153-103120175 CCCACTTCATTAGGCTGTCCGAT No data
Right 1122633702 14:103120195-103120217 AAAACACTTAGAACAACGCCTGG No data
1122633699_1122633702 18 Left 1122633699 14:103120154-103120176 CCACTTCATTAGGCTGTCCGATG No data
Right 1122633702 14:103120195-103120217 AAAACACTTAGAACAACGCCTGG No data
1122633701_1122633702 1 Left 1122633701 14:103120171-103120193 CCGATGAAATCGGCTAATGTATA No data
Right 1122633702 14:103120195-103120217 AAAACACTTAGAACAACGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122633702 Original CRISPR AAAACACTTAGAACAACGCC TGG Intergenic
No off target data available for this crispr