ID: 1122635313

View in Genome Browser
Species Human (GRCh38)
Location 14:103126996-103127018
Sequence CTTCAGCTCCTCCACTGCGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 196}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122635313_1122635322 13 Left 1122635313 14:103126996-103127018 CCGGCGCAGTGGAGGAGCTGAAG 0: 1
1: 0
2: 0
3: 25
4: 196
Right 1122635322 14:103127032-103127054 GCGGGCAGCTGGAGGCGGCGCGG 0: 1
1: 1
2: 6
3: 52
4: 513
1122635313_1122635317 -6 Left 1122635313 14:103126996-103127018 CCGGCGCAGTGGAGGAGCTGAAG 0: 1
1: 0
2: 0
3: 25
4: 196
Right 1122635317 14:103127013-103127035 CTGAAGGCGGCGCTGGAGCGCGG 0: 1
1: 0
2: 1
3: 13
4: 166
1122635313_1122635320 5 Left 1122635313 14:103126996-103127018 CCGGCGCAGTGGAGGAGCTGAAG 0: 1
1: 0
2: 0
3: 25
4: 196
Right 1122635320 14:103127024-103127046 GCTGGAGCGCGGGCAGCTGGAGG 0: 1
1: 0
2: 18
3: 58
4: 434
1122635313_1122635323 23 Left 1122635313 14:103126996-103127018 CCGGCGCAGTGGAGGAGCTGAAG 0: 1
1: 0
2: 0
3: 25
4: 196
Right 1122635323 14:103127042-103127064 GGAGGCGGCGCGGCCGCTGCTGG 0: 1
1: 0
2: 12
3: 128
4: 561
1122635313_1122635324 29 Left 1122635313 14:103126996-103127018 CCGGCGCAGTGGAGGAGCTGAAG 0: 1
1: 0
2: 0
3: 25
4: 196
Right 1122635324 14:103127048-103127070 GGCGCGGCCGCTGCTGGCGCTGG 0: 1
1: 1
2: 5
3: 43
4: 463
1122635313_1122635319 2 Left 1122635313 14:103126996-103127018 CCGGCGCAGTGGAGGAGCTGAAG 0: 1
1: 0
2: 0
3: 25
4: 196
Right 1122635319 14:103127021-103127043 GGCGCTGGAGCGCGGGCAGCTGG 0: 1
1: 0
2: 2
3: 52
4: 407
1122635313_1122635318 -5 Left 1122635313 14:103126996-103127018 CCGGCGCAGTGGAGGAGCTGAAG 0: 1
1: 0
2: 0
3: 25
4: 196
Right 1122635318 14:103127014-103127036 TGAAGGCGGCGCTGGAGCGCGGG 0: 1
1: 0
2: 0
3: 6
4: 166
1122635313_1122635321 8 Left 1122635313 14:103126996-103127018 CCGGCGCAGTGGAGGAGCTGAAG 0: 1
1: 0
2: 0
3: 25
4: 196
Right 1122635321 14:103127027-103127049 GGAGCGCGGGCAGCTGGAGGCGG 0: 2
1: 0
2: 3
3: 83
4: 608

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122635313 Original CRISPR CTTCAGCTCCTCCACTGCGC CGG (reversed) Exonic
900152653 1:1185427-1185449 TTTCAGATCCTCCACTTGGCAGG + Intronic
900816579 1:4851798-4851820 CTTCTGCTCCTCAGCTGTGCTGG + Intergenic
900879312 1:5369151-5369173 CTTCAGCCCCTTCTCTGCACAGG + Intergenic
901200204 1:7462721-7462743 CTGCCGCTCCTCCCCTGCCCTGG + Intronic
901789535 1:11647120-11647142 CTGCATCTCCACCACTGCACTGG + Intergenic
902608903 1:17585611-17585633 CTTCAGCTGCTCGACTGCAATGG - Intronic
902891710 1:19448906-19448928 CATCACCTCCTCCAATGCCCAGG - Intronic
903749434 1:25611649-25611671 CTTCAGCTCCTTCACTGAGGAGG - Intergenic
903950458 1:26993523-26993545 CTTCAGGTCCTGCCCTTCGCCGG - Intergenic
904130704 1:28273371-28273393 CATCAGCGCCTCCACGTCGCGGG - Exonic
905549268 1:38823140-38823162 GCTCAGCTCCTCCTCTGGGCTGG + Intergenic
906028409 1:42696231-42696253 CTCCATCTCCTACACTGCGAAGG - Exonic
907431562 1:54415078-54415100 CTTCCACTCCTCCACTGCCGGGG - Intergenic
908560453 1:65301129-65301151 CTTCAGCTTCTCAAGTGGGCTGG - Intronic
909713740 1:78681822-78681844 CATGAGCTTCTCCACTGTGCAGG + Intergenic
910345318 1:86229800-86229822 CTTCAGCTGCCACATTGCGCTGG + Intergenic
911322174 1:96428154-96428176 TTTCAGCTCCTCCACTTCGAAGG + Intergenic
912481504 1:109985081-109985103 CTTCAGCTCCTCCCCGACCCCGG - Exonic
912659428 1:111515159-111515181 GGTCAGCTCTTCCACTGCGGAGG + Intronic
914244546 1:145875977-145875999 CTTCAGAACCTCCACTGGGAAGG + Intronic
915552146 1:156641552-156641574 AGTCAGCTCCTCCTCTGTGCAGG + Intronic
918040539 1:180911918-180911940 CTTCCCCTCCTCCCCTGCCCCGG + Intergenic
920032159 1:203044028-203044050 CTTCAGCACCTCCACCTCACTGG - Intronic
920434630 1:205940011-205940033 CTGCCCCTCCTCCACTGTGCAGG + Intronic
920746282 1:208631990-208632012 GTTCTTCTCCTCCACTGCGGTGG + Intergenic
921191246 1:212710587-212710609 CTTCAGCCCATCCACTTCCCAGG - Intergenic
922337567 1:224630293-224630315 CTTCAGCTCCTCTGCAGCACAGG - Intronic
922705615 1:227788632-227788654 CTTCCGCTCCTCCGCCGCCCGGG - Intergenic
923575720 1:235157280-235157302 CTTCACCTCCTTCCCTGCTCTGG - Intronic
1065876802 10:30004216-30004238 GTTCAGCTACTCCTCTGTGCTGG - Intergenic
1067066106 10:43105162-43105184 CTTGAACTCCACCACGGCGCTGG - Exonic
1067836830 10:49646606-49646628 CTCCAGCTCCTTCACGGCGGAGG + Exonic
1070623786 10:78034124-78034146 CAACAGCTCCTGCACTGCCCAGG - Intronic
1073137151 10:101226368-101226390 CCTCACCTCCTCCACAGCTCTGG - Exonic
1075177703 10:120181348-120181370 CTTCAGCTCCTCTACTGGCCTGG - Intergenic
1075472083 10:122698749-122698771 CTTCAGCTCCTACCTTGCACTGG - Intronic
1075501651 10:122980370-122980392 GGCCAGTTCCTCCACTGCGCCGG + Exonic
1075795807 10:125118699-125118721 CCCCAGCGCCTCCACTGCACTGG - Intronic
1077104750 11:837326-837348 CTGCAGCTGGTCCACAGCGCTGG - Exonic
1077503874 11:2921483-2921505 TCTCAGCTCCTCCACTAAGCAGG - Intronic
1080551263 11:33375935-33375957 CTTAAGGACCTCCGCTGCGCGGG + Intergenic
1081699165 11:45141900-45141922 TTTCAGCTTCTCCAGTGGGCAGG + Intronic
1081770816 11:45649739-45649761 CTTCAGCTCCTCCTCCGAGGCGG + Exonic
1082810797 11:57477680-57477702 CTTCAGCTCCTCCTCATGGCGGG - Intergenic
1084457387 11:69275934-69275956 CTTCCTCTGCTCCACTGCACAGG - Intergenic
1084628149 11:70324944-70324966 TTTCAGCACTTCCACTTCGCTGG - Exonic
1084723436 11:70924406-70924428 CTTCAGCCCCACCATTTCGCTGG - Intronic
1085027635 11:73245907-73245929 CTTCAGCTCCTTCACCGAGGAGG - Intergenic
1085047746 11:73363248-73363270 CTCCTGCTCCTCCTCTGAGCTGG - Exonic
1088785662 11:113179467-113179489 CCTCAGCTCACCCACTGTGCAGG + Intronic
1090206540 11:124887428-124887450 CCTCAGCTCCTCAAATGAGCTGG - Exonic
1090264014 11:125342820-125342842 CTCCAGCTCCTCCACGGTGGTGG - Intronic
1091327358 11:134701121-134701143 CTGCAGCCCCTCCACTGCTGTGG - Intergenic
1092530557 12:9341039-9341061 CTTCTCCTCCTTCACTGCACAGG + Intergenic
1092987865 12:13864311-13864333 GCTCAGCTGCTCCACTGCGGAGG + Intronic
1097548525 12:61036310-61036332 CTCCAGATGCTCCACTGTGCTGG - Intergenic
1100864881 12:98846518-98846540 TTTCGGCTCATCCACTGCACAGG - Intronic
1101870718 12:108563065-108563087 CTTCAGCCACTCCGCTGCCCTGG + Intronic
1102056998 12:109904044-109904066 CCTCAGCTCCTCCAGTTCTCTGG - Exonic
1103125836 12:118421615-118421637 CTTCATCACCTCCACTGGGCAGG - Intergenic
1103128485 12:118445987-118446009 CGTCAGCTCCTGCACTCCACTGG - Intergenic
1104019213 12:124980544-124980566 CTGCAGCCCCACCACTGCCCAGG - Exonic
1105070996 12:133234638-133234660 CAACAGCTCCTCCACTGCTCTGG + Exonic
1105963667 13:25366072-25366094 CTTCAGCTCGAACACCGCGCTGG + Intergenic
1106992919 13:35444990-35445012 CTTCAGCTCCTCCACTAGATTGG - Intronic
1107684356 13:42881684-42881706 CTTCAGCTCCTCACCTTCCCTGG - Intergenic
1108825436 13:54407663-54407685 CTTCAGCTTCTCCAATGGGGAGG - Intergenic
1113162024 13:107392393-107392415 CTTCAGCTGCTCCAGTTCACAGG + Intronic
1113546134 13:111152973-111152995 CCTGCGCTCCTCCACTGCGGTGG + Intronic
1114693888 14:24608987-24609009 CCTCAGCTACTCCACTGACCTGG - Intronic
1118046191 14:61974125-61974147 CTACAGTTCCTCCAGTGAGCAGG + Intergenic
1118463851 14:66013483-66013505 CTCCATCTCCTACACTGCGAAGG + Intergenic
1118885985 14:69866207-69866229 CCCCAGCTCGGCCACTGCGCAGG + Intronic
1121525934 14:94619330-94619352 CTTCAGCTCCACCACGGTGCAGG - Exonic
1121526062 14:94620376-94620398 CTTCAGCTCCACCACGGTGCAGG + Intronic
1122635313 14:103126996-103127018 CTTCAGCTCCTCCACTGCGCCGG - Exonic
1122842735 14:104474317-104474339 CCCCAGCTCCTGCCCTGCGCTGG - Intergenic
1122861650 14:104585189-104585211 CTTCAGGTTCTCCCCTGCCCTGG - Intronic
1123412073 15:20068811-20068833 CTTCAGCTCCTCCCCATCCCTGG - Intergenic
1123521417 15:21075931-21075953 CTTCAGCTCCTCCCCATCCCTGG - Intergenic
1123945715 15:25237909-25237931 CCTCAGCTCCTGCACTGAGCTGG + Intergenic
1123948144 15:25248779-25248801 CAACAGCACCTCCACTGCTCGGG - Intergenic
1124034528 15:26042566-26042588 CTTCAGCTCCTCCAATGCCTGGG + Intergenic
1124116422 15:26847484-26847506 CTTCTGCTCCTCCCCTGAGTTGG + Intronic
1128414911 15:67436293-67436315 CTTCAGCTTCTCCAGTGCGGGGG - Intronic
1129323853 15:74789342-74789364 CCTCAGCACCCCCACTGCACAGG - Intronic
1130420331 15:83739742-83739764 CTTCACCTCCTCCAGTGCCAAGG + Intronic
1131269079 15:90935545-90935567 CCGCAGCTGCTCCACTGAGCTGG - Exonic
1132793772 16:1708169-1708191 GTTCAGCCCCTCCACTTCTCAGG - Intronic
1134504161 16:14791738-14791760 CCTCAGCTACTCCTCTGGGCAGG + Intronic
1134576412 16:15337170-15337192 CCTCAGCTACTCCTCTGGGCAGG - Intergenic
1134726033 16:16419331-16419353 CCTCAGCTACTCCTCTGGGCAGG + Intergenic
1134877623 16:17716030-17716052 ATTCAGTTCCTTCACTGCCCTGG + Intergenic
1134941402 16:18292529-18292551 CCTCAGCTACTCCTCTGGGCAGG - Intergenic
1136183818 16:28573248-28573270 CTCCAGCTCCTCCTCTGGGCTGG - Intronic
1136344251 16:29664792-29664814 CTTCAGCTCCTCCATCGCCAGGG - Exonic
1137587662 16:49673512-49673534 CTGCAGCTCCCACACTGCCCTGG + Intronic
1138361471 16:56432686-56432708 CTTTTACTTCTCCACTGCGCAGG + Exonic
1139447501 16:67006852-67006874 CTTCAGGTCCAGCACTGGGCAGG - Intronic
1142257826 16:89023794-89023816 CTTCCCCACCTCCACTGCTCGGG + Intergenic
1144081219 17:11766031-11766053 CTTCAAGTGCTCCAGTGCGCAGG - Intronic
1145252875 17:21305910-21305932 CGTCAGCTCCTTCCCTGCCCAGG + Intronic
1145323700 17:21782006-21782028 CATCAGCTCCTTCCCTGCCCAGG - Intergenic
1147450509 17:40501134-40501156 CTTCAGCTTCTCCATTTCTCAGG - Intronic
1147601458 17:41748446-41748468 CATCAGCTCCTCCAGTTCCCAGG + Intergenic
1147677591 17:42218773-42218795 CAGCATCTCCTCCACTGGGCCGG + Exonic
1147688448 17:42300798-42300820 CAGCATCTCCTCCACTGGGCCGG - Exonic
1148161548 17:45453182-45453204 CTTCTGCTCCTCCCCAGCCCCGG - Intronic
1148383961 17:47221370-47221392 CCTCAGCTCCTCCGCTTGGCTGG + Intronic
1148386811 17:47239977-47239999 CCTCACCTCCTTCACTGCACAGG - Intergenic
1150124888 17:62629202-62629224 CTTCCTCTGCTCCTCTGCGCAGG + Intronic
1150392784 17:64799827-64799849 CTTCTGCTCCTCCCCAGCCCCGG - Intergenic
1152357932 17:79815555-79815577 CTTCAGCTGCCCGACTGCGGTGG + Intergenic
1156273132 18:35555674-35555696 CCTCAGCTTCTCCAATGTGCAGG + Intergenic
1159948417 18:74460633-74460655 CTGCAGCTGCTCCAATGAGCGGG + Intergenic
1160535700 18:79590224-79590246 GTTCTGCTCCCCCACTGCCCGGG - Intergenic
1161610437 19:5239013-5239035 CTTCAGGTCCTCCACCACGTAGG + Exonic
1164676664 19:30105654-30105676 TTTCAGCTCTGCCACTGCCCTGG + Intergenic
1165099777 19:33432136-33432158 CCTGAGCTGCTCCACTGCACCGG + Intronic
1167208378 19:48117686-48117708 CTTCACCTCCCACACAGCGCTGG + Exonic
925246159 2:2385218-2385240 CTCCATCTCCACAACTGCGCAGG - Intergenic
927883749 2:26706293-26706315 CTCCAGCTCCTCCTCTGGGGGGG - Intronic
928221781 2:29409401-29409423 CTTCAGCTCCTGCTCTGGTCAGG + Intronic
928922660 2:36541671-36541693 CTTGAGTTCCTCCAAAGCGCAGG + Intronic
930274524 2:49296076-49296098 CTTGGGCTCCTCCGCTGCACAGG - Intergenic
930817388 2:55612466-55612488 CTTCAGCACCTCCATGGTGCTGG - Intronic
937286530 2:120757652-120757674 GTTCAGCTCTTCCACTGGTCTGG + Intronic
938061961 2:128261582-128261604 CTTCAGCAGCTCCACTGCAGGGG - Intronic
939810390 2:146824758-146824780 CTTCAGTTCCTCAAGTGCTCTGG + Intergenic
942261749 2:174172140-174172162 CTCCAGCTCCTCCACTGCCAAGG - Intronic
942869999 2:180722984-180723006 CTTCAACTCCAGCACTGCCCAGG + Intergenic
943116051 2:183671878-183671900 CTTCATATCCTTCACTGCGTAGG - Intergenic
944302069 2:198134818-198134840 CTTCACCACCTCCACAGTGCTGG - Intronic
947825921 2:233105882-233105904 CTTCATCTCATCCCCTGTGCAGG - Intronic
1169252429 20:4070984-4071006 CATCAGCCCCTCCTCTGCTCTGG - Intronic
1169392574 20:5202495-5202517 CTGCAGTTCCTCCACAGCACAGG - Intergenic
1170568617 20:17620669-17620691 CTTCATGTGCTCCACGGCGCCGG + Intronic
1171900730 20:30853851-30853873 CCTCAGCTCATCCACTGCCTTGG - Intergenic
1173007454 20:39151087-39151109 CTTCACCTCCTCCCCAGAGCTGG + Intergenic
1174487251 20:50869287-50869309 CCTGAGCTCCTCCACTTGGCCGG + Intronic
1175422032 20:58840669-58840691 CTTGAGCTCCTCCCCTTCCCTGG - Intronic
1175530921 20:59673881-59673903 CTTCTCCTCTTCCACTGTGCAGG - Intronic
1175540036 20:59742709-59742731 CTTCAGCTCCTCCATTGAATAGG - Intronic
1176306444 21:5125958-5125980 CTTCAGCCCCTCCACGGCTCAGG + Exonic
1177385535 21:20405171-20405193 CCTCAGCCCCTACACTGAGCTGG - Intergenic
1178624346 21:34202778-34202800 CATCCCCTCCTCCCCTGCGCTGG - Intergenic
1179850615 21:44136072-44136094 CTTCAGCCCCTCCACGGCTCAGG - Exonic
1180320942 22:11320911-11320933 CCTCAGCTCATCCACTGCCTTGG + Intergenic
1180334101 22:11559834-11559856 CCTCAGCTCATCCACTGCCTTGG - Intergenic
1181338794 22:22162229-22162251 CCTCTCCTCCTCCACTGCACAGG + Intergenic
1182950963 22:34375421-34375443 CAAGAGCTACTCCACTGCGCTGG + Intergenic
1183225517 22:36547288-36547310 CTCCATCTCCTCCACTGCTCTGG - Intergenic
950510728 3:13424819-13424841 CTTCAGCACCACCTCTGAGCTGG + Intergenic
952582203 3:34847615-34847637 TTTCAGCTCCTGCACTTCCCAGG - Intergenic
961524182 3:127486105-127486127 CTGCAGCTCCGCCACTGCTGTGG - Intergenic
962677872 3:137769805-137769827 CTTCATCTCCTCCCCAGCTCAGG + Intergenic
965701172 3:171460415-171460437 CATCAACTCCTCCACTCAGCAGG + Intergenic
968452153 4:680828-680850 CTTCAGCTCCTGCTAGGCGCCGG + Intronic
969625683 4:8304180-8304202 CTTCAGCTCATCCACCAGGCTGG - Exonic
974020813 4:56690621-56690643 CTTCAGCTCCTCTGCTGTTCTGG - Intergenic
974626289 4:64431839-64431861 CTTCAGCAGCTGCTCTGCGCTGG - Intergenic
976608551 4:87006234-87006256 CTTCAGCTCCTCCGGTGTGCTGG + Intronic
979279018 4:118843597-118843619 CTGCATCTCCTCCACTCCTCAGG - Intergenic
982197344 4:152929645-152929667 CCTCAGCAGCTCCACTGCACGGG - Intergenic
984768589 4:183418880-183418902 CTTCAGCTCCTCACCTTGGCGGG + Intergenic
986048477 5:4064120-4064142 CTCCAGCGGCTCCACTGCTCAGG - Intergenic
986107353 5:4672541-4672563 CTCCAGCTCCTCCTCTGCCTTGG + Intergenic
986315842 5:6585897-6585919 CTCCAGCTCTGCCACTGGGCCGG + Intergenic
986718300 5:10539769-10539791 TCTCTGGTCCTCCACTGCGCTGG - Intergenic
992557196 5:77915626-77915648 CTTCAGCACTTCCACTGCTGGGG + Intergenic
995491038 5:112691964-112691986 CATCAGCTCCTCCAGTGCACAGG + Intergenic
998385812 5:141756558-141756580 CTTCACCTCCTCCTCTGCTCAGG + Intergenic
999314247 5:150574049-150574071 TTTCAGCTCCTCCGCGGCGCTGG - Intergenic
1000273190 5:159706441-159706463 GTTCAGCTCCTCCACCTTGCAGG - Intergenic
1001102178 5:168823451-168823473 CTTCAGCTGCTCCACTGGCTGGG - Intronic
1001427009 5:171629362-171629384 CTTCTGCTCCTCCATTTTGCAGG + Intergenic
1004200824 6:13546374-13546396 CTAGAGCTCCTCCATTGTGCAGG - Intergenic
1005900733 6:30214354-30214376 ATTCAGCTCGTGCACTGGGCTGG + Intergenic
1007478187 6:42133175-42133197 CTTTAGCTCCTCGACTGAGGAGG - Intronic
1013402871 6:109815617-109815639 CTTCCCCTTCTCCACTGCACAGG - Intronic
1015843107 6:137493736-137493758 CTTCATCTCCTCCAGGGAGCTGG + Exonic
1017788289 6:157774213-157774235 CTCCACCTCCTCCACTCCCCTGG - Intronic
1023477158 7:40593178-40593200 GTTCAGCTCCTCCCCTGCTCTGG - Intronic
1024864413 7:53888166-53888188 CCTCTGCTACTCCACTGTGCAGG - Intergenic
1026576293 7:71574346-71574368 ATTCAGCTCCCCCACTGCTCAGG + Intronic
1026966814 7:74445449-74445471 CCTTAGCTCCTCTACTGCTCAGG - Intergenic
1030055792 7:105582910-105582932 CTTCATCTCCTACACTGCGAAGG + Intronic
1031918402 7:127584274-127584296 TTTCAGCTCCTCCACCTCACGGG + Exonic
1032671195 7:134083917-134083939 CTTCTGCTCCTCTACTGTGTGGG + Intergenic
1033244461 7:139706625-139706647 TTTCAGCCCCTCCCCTGCTCTGG + Intronic
1034281964 7:149860895-149860917 CTGCAGCTCCTCCAAAGCACGGG + Exonic
1034343064 7:150370159-150370181 GTTCAGCTCTTCCACAGCTCAGG - Intronic
1035893342 8:3370475-3370497 CTGCAGCACCTCCACTGTGATGG + Intronic
1040544963 8:48392017-48392039 CACCAGCTCCTCCAGTGTGCCGG - Intergenic
1040868843 8:52079380-52079402 CTGCAGCTACTCCACCCCGCAGG - Intergenic
1041484492 8:58359336-58359358 TGTCAGCTTCCCCACTGCGCAGG - Intergenic
1042611554 8:70607442-70607464 CTGGCGCGCCTCCACTGCGCCGG + Intronic
1043195366 8:77286758-77286780 CTTCTCCTCCTCCAATGCTCAGG - Intergenic
1043437407 8:80248036-80248058 CTTCAGCTCCTGCCATGTGCAGG - Intergenic
1044299246 8:90564707-90564729 CTGCAACACCTCCACTGTGCTGG + Intergenic
1044954273 8:97463203-97463225 CTTCAGATCCACCACTGTGCTGG - Intergenic
1047499318 8:125429948-125429970 CTTCGGCTTCTCCGCTGAGCTGG + Intergenic
1049105183 8:140608448-140608470 CTGCAGCTCCTCTGCTTCGCCGG + Intronic
1049918437 9:341152-341174 TTTCAGTTCCTCCATTGCACTGG - Intronic
1052785904 9:32828142-32828164 CTTCAGCTGCTCCAAGGCTCCGG - Intergenic
1053181199 9:35971999-35972021 CTCCATCTCCTACACTGCGAAGG + Intergenic
1056472110 9:86915983-86916005 CTTCAGCTCTTCCAAAGCACAGG - Intergenic
1056970289 9:91195699-91195721 CTTGAGCTCCTCCCCTGATCTGG + Intergenic
1059325222 9:113500258-113500280 CTTCAGCTCCTGTGCTGTGCAGG + Intronic
1060195078 9:121618210-121618232 GTTCAGTTTCTCCACTGAGCTGG + Intronic
1061505154 9:131027564-131027586 ATCCAGTTCCTCAACTGCGCTGG - Intronic
1062008066 9:134251499-134251521 CTTCTGCTCCTCCTCTGCTCAGG + Intergenic
1062382058 9:136291244-136291266 CTGGAGCTCCTCCACTGCACGGG - Exonic
1186509285 X:10118309-10118331 GTTCAGCTCCTCCTCGGAGCTGG + Intronic
1187430767 X:19222143-19222165 CTTCTGCTTCTCCAGTGCGGGGG + Intergenic
1188461776 X:30435457-30435479 CTACAGCTCCACCACTGAGAAGG + Intergenic
1192506249 X:71685380-71685402 CTTCAGCTCCACCCCAGTGCCGG - Intergenic
1192520448 X:71796168-71796190 CTTCAGCTCCACCCCAGTGCCGG + Intergenic
1193253498 X:79320079-79320101 CTTCAGCTTTTCCAGTGCGGGGG + Intergenic
1201718961 Y:17076610-17076632 GTTCTGTTCCTCCACTGTGCAGG + Intergenic
1201719301 Y:17079247-17079269 TTTCTGTTCCTCCACTGTGCAGG - Intergenic
1201719780 Y:17083853-17083875 TTTCTGTTCCTCCACTGTGCAGG + Intergenic