ID: 1122637888

View in Genome Browser
Species Human (GRCh38)
Location 14:103138786-103138808
Sequence GAGTCCCCCAGCGCGGGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122637876_1122637888 11 Left 1122637876 14:103138752-103138774 CCCGGAGAGGAGGATCTGCCCGG No data
Right 1122637888 14:103138786-103138808 GAGTCCCCCAGCGCGGGGACAGG No data
1122637874_1122637888 13 Left 1122637874 14:103138750-103138772 CCCCCGGAGAGGAGGATCTGCCC No data
Right 1122637888 14:103138786-103138808 GAGTCCCCCAGCGCGGGGACAGG No data
1122637883_1122637888 -7 Left 1122637883 14:103138770-103138792 CCCGGCGGAGGGGAGCGAGTCCC No data
Right 1122637888 14:103138786-103138808 GAGTCCCCCAGCGCGGGGACAGG No data
1122637884_1122637888 -8 Left 1122637884 14:103138771-103138793 CCGGCGGAGGGGAGCGAGTCCCC No data
Right 1122637888 14:103138786-103138808 GAGTCCCCCAGCGCGGGGACAGG No data
1122637875_1122637888 12 Left 1122637875 14:103138751-103138773 CCCCGGAGAGGAGGATCTGCCCG No data
Right 1122637888 14:103138786-103138808 GAGTCCCCCAGCGCGGGGACAGG No data
1122637878_1122637888 10 Left 1122637878 14:103138753-103138775 CCGGAGAGGAGGATCTGCCCGGC No data
Right 1122637888 14:103138786-103138808 GAGTCCCCCAGCGCGGGGACAGG No data
1122637872_1122637888 23 Left 1122637872 14:103138740-103138762 CCAGGAAAATCCCCCGGAGAGGA No data
Right 1122637888 14:103138786-103138808 GAGTCCCCCAGCGCGGGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122637888 Original CRISPR GAGTCCCCCAGCGCGGGGAC AGG Intergenic
No off target data available for this crispr