ID: 1122638525

View in Genome Browser
Species Human (GRCh38)
Location 14:103142567-103142589
Sequence CTGAGGATCTGGCGATAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122638525_1122638529 14 Left 1122638525 14:103142567-103142589 CCATCTTATCGCCAGATCCTCAG No data
Right 1122638529 14:103142604-103142626 TCAGTTAGCTCGCTGCAACCTGG No data
1122638525_1122638530 15 Left 1122638525 14:103142567-103142589 CCATCTTATCGCCAGATCCTCAG No data
Right 1122638530 14:103142605-103142627 CAGTTAGCTCGCTGCAACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122638525 Original CRISPR CTGAGGATCTGGCGATAAGA TGG (reversed) Intergenic
No off target data available for this crispr