ID: 1122639139

View in Genome Browser
Species Human (GRCh38)
Location 14:103147064-103147086
Sequence GGGGTCTCACTATGTTGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 609854
Summary {0: 3152, 1: 14672, 2: 56782, 3: 188710, 4: 346538}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122639139_1122639147 18 Left 1122639139 14:103147064-103147086 CCTGGGCAACATAGTGAGACCCC 0: 3152
1: 14672
2: 56782
3: 188710
4: 346538
Right 1122639147 14:103147105-103147127 TTTGCCTCTTTCTTCATAGTAGG No data
1122639139_1122639149 24 Left 1122639139 14:103147064-103147086 CCTGGGCAACATAGTGAGACCCC 0: 3152
1: 14672
2: 56782
3: 188710
4: 346538
Right 1122639149 14:103147111-103147133 TCTTTCTTCATAGTAGGTAGTGG No data
1122639139_1122639151 28 Left 1122639139 14:103147064-103147086 CCTGGGCAACATAGTGAGACCCC 0: 3152
1: 14672
2: 56782
3: 188710
4: 346538
Right 1122639151 14:103147115-103147137 TCTTCATAGTAGGTAGTGGGAGG No data
1122639139_1122639150 25 Left 1122639139 14:103147064-103147086 CCTGGGCAACATAGTGAGACCCC 0: 3152
1: 14672
2: 56782
3: 188710
4: 346538
Right 1122639150 14:103147112-103147134 CTTTCTTCATAGTAGGTAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122639139 Original CRISPR GGGGTCTCACTATGTTGCCC AGG (reversed) Intergenic
Too many off-targets to display for this crispr