ID: 1122639143

View in Genome Browser
Species Human (GRCh38)
Location 14:103147086-103147108
Sequence CAAATGCTTGGAAGGGCTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122639143_1122639147 -4 Left 1122639143 14:103147086-103147108 CCAAAAGCCCTTCCAAGCATTTG No data
Right 1122639147 14:103147105-103147127 TTTGCCTCTTTCTTCATAGTAGG No data
1122639143_1122639149 2 Left 1122639143 14:103147086-103147108 CCAAAAGCCCTTCCAAGCATTTG No data
Right 1122639149 14:103147111-103147133 TCTTTCTTCATAGTAGGTAGTGG No data
1122639143_1122639150 3 Left 1122639143 14:103147086-103147108 CCAAAAGCCCTTCCAAGCATTTG No data
Right 1122639150 14:103147112-103147134 CTTTCTTCATAGTAGGTAGTGGG No data
1122639143_1122639151 6 Left 1122639143 14:103147086-103147108 CCAAAAGCCCTTCCAAGCATTTG No data
Right 1122639151 14:103147115-103147137 TCTTCATAGTAGGTAGTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122639143 Original CRISPR CAAATGCTTGGAAGGGCTTT TGG (reversed) Intergenic
No off target data available for this crispr