ID: 1122639144

View in Genome Browser
Species Human (GRCh38)
Location 14:103147093-103147115
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122639144_1122639151 -1 Left 1122639144 14:103147093-103147115 CCCTTCCAAGCATTTGCCTCTTT No data
Right 1122639151 14:103147115-103147137 TCTTCATAGTAGGTAGTGGGAGG No data
1122639144_1122639150 -4 Left 1122639144 14:103147093-103147115 CCCTTCCAAGCATTTGCCTCTTT No data
Right 1122639150 14:103147112-103147134 CTTTCTTCATAGTAGGTAGTGGG No data
1122639144_1122639149 -5 Left 1122639144 14:103147093-103147115 CCCTTCCAAGCATTTGCCTCTTT No data
Right 1122639149 14:103147111-103147133 TCTTTCTTCATAGTAGGTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122639144 Original CRISPR AAAGAGGCAAATGCTTGGAA GGG (reversed) Intergenic
No off target data available for this crispr