ID: 1122639147

View in Genome Browser
Species Human (GRCh38)
Location 14:103147105-103147127
Sequence TTTGCCTCTTTCTTCATAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122639139_1122639147 18 Left 1122639139 14:103147064-103147086 CCTGGGCAACATAGTGAGACCCC 0: 3152
1: 14672
2: 56782
3: 188710
4: 346538
Right 1122639147 14:103147105-103147127 TTTGCCTCTTTCTTCATAGTAGG No data
1122639141_1122639147 -2 Left 1122639141 14:103147084-103147106 CCCCAAAAGCCCTTCCAAGCATT No data
Right 1122639147 14:103147105-103147127 TTTGCCTCTTTCTTCATAGTAGG No data
1122639142_1122639147 -3 Left 1122639142 14:103147085-103147107 CCCAAAAGCCCTTCCAAGCATTT No data
Right 1122639147 14:103147105-103147127 TTTGCCTCTTTCTTCATAGTAGG No data
1122639143_1122639147 -4 Left 1122639143 14:103147086-103147108 CCAAAAGCCCTTCCAAGCATTTG No data
Right 1122639147 14:103147105-103147127 TTTGCCTCTTTCTTCATAGTAGG No data
1122639140_1122639147 -1 Left 1122639140 14:103147083-103147105 CCCCCAAAAGCCCTTCCAAGCAT No data
Right 1122639147 14:103147105-103147127 TTTGCCTCTTTCTTCATAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122639147 Original CRISPR TTTGCCTCTTTCTTCATAGT AGG Intergenic
No off target data available for this crispr