ID: 1122639150

View in Genome Browser
Species Human (GRCh38)
Location 14:103147112-103147134
Sequence CTTTCTTCATAGTAGGTAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122639146_1122639150 -9 Left 1122639146 14:103147098-103147120 CCAAGCATTTGCCTCTTTCTTCA No data
Right 1122639150 14:103147112-103147134 CTTTCTTCATAGTAGGTAGTGGG No data
1122639143_1122639150 3 Left 1122639143 14:103147086-103147108 CCAAAAGCCCTTCCAAGCATTTG No data
Right 1122639150 14:103147112-103147134 CTTTCTTCATAGTAGGTAGTGGG No data
1122639140_1122639150 6 Left 1122639140 14:103147083-103147105 CCCCCAAAAGCCCTTCCAAGCAT No data
Right 1122639150 14:103147112-103147134 CTTTCTTCATAGTAGGTAGTGGG No data
1122639141_1122639150 5 Left 1122639141 14:103147084-103147106 CCCCAAAAGCCCTTCCAAGCATT No data
Right 1122639150 14:103147112-103147134 CTTTCTTCATAGTAGGTAGTGGG No data
1122639142_1122639150 4 Left 1122639142 14:103147085-103147107 CCCAAAAGCCCTTCCAAGCATTT No data
Right 1122639150 14:103147112-103147134 CTTTCTTCATAGTAGGTAGTGGG No data
1122639144_1122639150 -4 Left 1122639144 14:103147093-103147115 CCCTTCCAAGCATTTGCCTCTTT No data
Right 1122639150 14:103147112-103147134 CTTTCTTCATAGTAGGTAGTGGG No data
1122639145_1122639150 -5 Left 1122639145 14:103147094-103147116 CCTTCCAAGCATTTGCCTCTTTC No data
Right 1122639150 14:103147112-103147134 CTTTCTTCATAGTAGGTAGTGGG No data
1122639139_1122639150 25 Left 1122639139 14:103147064-103147086 CCTGGGCAACATAGTGAGACCCC 0: 3152
1: 14672
2: 56782
3: 188710
4: 346538
Right 1122639150 14:103147112-103147134 CTTTCTTCATAGTAGGTAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122639150 Original CRISPR CTTTCTTCATAGTAGGTAGT GGG Intergenic
No off target data available for this crispr