ID: 1122641396

View in Genome Browser
Species Human (GRCh38)
Location 14:103161743-103161765
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122641396_1122641397 6 Left 1122641396 14:103161743-103161765 CCAGTCTTCATGTCAGCATGCAG No data
Right 1122641397 14:103161772-103161794 CTCACCCCATGTGCAGTTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122641396 Original CRISPR CTGCATGCTGACATGAAGAC TGG (reversed) Intergenic
No off target data available for this crispr