ID: 1122641397

View in Genome Browser
Species Human (GRCh38)
Location 14:103161772-103161794
Sequence CTCACCCCATGTGCAGTTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122641396_1122641397 6 Left 1122641396 14:103161743-103161765 CCAGTCTTCATGTCAGCATGCAG No data
Right 1122641397 14:103161772-103161794 CTCACCCCATGTGCAGTTTTAGG No data
1122641395_1122641397 12 Left 1122641395 14:103161737-103161759 CCAAGGCCAGTCTTCATGTCAGC No data
Right 1122641397 14:103161772-103161794 CTCACCCCATGTGCAGTTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122641397 Original CRISPR CTCACCCCATGTGCAGTTTT AGG Intergenic
No off target data available for this crispr