ID: 1122642510

View in Genome Browser
Species Human (GRCh38)
Location 14:103168401-103168423
Sequence CACTGTCCAAGTCAACTGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122642510_1122642515 12 Left 1122642510 14:103168401-103168423 CCACTCAGTTGACTTGGACAGTG No data
Right 1122642515 14:103168436-103168458 TTCTGCCCACTTGTTTGGGCAGG No data
1122642510_1122642514 8 Left 1122642510 14:103168401-103168423 CCACTCAGTTGACTTGGACAGTG No data
Right 1122642514 14:103168432-103168454 GCGGTTCTGCCCACTTGTTTGGG No data
1122642510_1122642513 7 Left 1122642510 14:103168401-103168423 CCACTCAGTTGACTTGGACAGTG No data
Right 1122642513 14:103168431-103168453 AGCGGTTCTGCCCACTTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122642510 Original CRISPR CACTGTCCAAGTCAACTGAG TGG (reversed) Intergenic
No off target data available for this crispr