ID: 1122642826

View in Genome Browser
Species Human (GRCh38)
Location 14:103170600-103170622
Sequence GGGTCTTCATAGCCCCACGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122642826_1122642832 9 Left 1122642826 14:103170600-103170622 CCAACGTGGGGCTATGAAGACCC No data
Right 1122642832 14:103170632-103170654 AACACTAGAGCATGCGGAACTGG No data
1122642826_1122642831 3 Left 1122642826 14:103170600-103170622 CCAACGTGGGGCTATGAAGACCC No data
Right 1122642831 14:103170626-103170648 TGAAGGAACACTAGAGCATGCGG No data
1122642826_1122642833 12 Left 1122642826 14:103170600-103170622 CCAACGTGGGGCTATGAAGACCC No data
Right 1122642833 14:103170635-103170657 ACTAGAGCATGCGGAACTGGAGG No data
1122642826_1122642834 27 Left 1122642826 14:103170600-103170622 CCAACGTGGGGCTATGAAGACCC No data
Right 1122642834 14:103170650-103170672 ACTGGAGGACGCATTGTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122642826 Original CRISPR GGGTCTTCATAGCCCCACGT TGG (reversed) Intergenic
No off target data available for this crispr