ID: 1122645120

View in Genome Browser
Species Human (GRCh38)
Location 14:103189120-103189142
Sequence CCCACAGAGCTCCCCAGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122645106_1122645120 13 Left 1122645106 14:103189084-103189106 CCACGCCCGGGTGCCCCCAGGGG No data
Right 1122645120 14:103189120-103189142 CCCACAGAGCTCCCCAGGCCTGG No data
1122645112_1122645120 0 Left 1122645112 14:103189097-103189119 CCCCCAGGGGGCGCCGGCTTCCA No data
Right 1122645120 14:103189120-103189142 CCCACAGAGCTCCCCAGGCCTGG No data
1122645100_1122645120 25 Left 1122645100 14:103189072-103189094 CCGAGGCCCTCGCCACGCCCGGG No data
Right 1122645120 14:103189120-103189142 CCCACAGAGCTCCCCAGGCCTGG No data
1122645103_1122645120 18 Left 1122645103 14:103189079-103189101 CCTCGCCACGCCCGGGTGCCCCC No data
Right 1122645120 14:103189120-103189142 CCCACAGAGCTCCCCAGGCCTGG No data
1122645110_1122645120 7 Left 1122645110 14:103189090-103189112 CCGGGTGCCCCCAGGGGGCGCCG No data
Right 1122645120 14:103189120-103189142 CCCACAGAGCTCCCCAGGCCTGG No data
1122645115_1122645120 -3 Left 1122645115 14:103189100-103189122 CCAGGGGGCGCCGGCTTCCACCC No data
Right 1122645120 14:103189120-103189142 CCCACAGAGCTCCCCAGGCCTGG No data
1122645113_1122645120 -1 Left 1122645113 14:103189098-103189120 CCCCAGGGGGCGCCGGCTTCCAC No data
Right 1122645120 14:103189120-103189142 CCCACAGAGCTCCCCAGGCCTGG No data
1122645102_1122645120 19 Left 1122645102 14:103189078-103189100 CCCTCGCCACGCCCGGGTGCCCC No data
Right 1122645120 14:103189120-103189142 CCCACAGAGCTCCCCAGGCCTGG No data
1122645098_1122645120 28 Left 1122645098 14:103189069-103189091 CCGCCGAGGCCCTCGCCACGCCC No data
Right 1122645120 14:103189120-103189142 CCCACAGAGCTCCCCAGGCCTGG No data
1122645114_1122645120 -2 Left 1122645114 14:103189099-103189121 CCCAGGGGGCGCCGGCTTCCACC No data
Right 1122645120 14:103189120-103189142 CCCACAGAGCTCCCCAGGCCTGG No data
1122645109_1122645120 8 Left 1122645109 14:103189089-103189111 CCCGGGTGCCCCCAGGGGGCGCC No data
Right 1122645120 14:103189120-103189142 CCCACAGAGCTCCCCAGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122645120 Original CRISPR CCCACAGAGCTCCCCAGGCC TGG Intergenic
No off target data available for this crispr