ID: 1122646927

View in Genome Browser
Species Human (GRCh38)
Location 14:103201052-103201074
Sequence CAGAAGAATTAGGTGGGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122646927_1122646934 3 Left 1122646927 14:103201052-103201074 CCCCACCCCACCTAATTCTTCTG No data
Right 1122646934 14:103201078-103201100 AACCTTCCAGCTCAATCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122646927 Original CRISPR CAGAAGAATTAGGTGGGGTG GGG (reversed) Intergenic
No off target data available for this crispr